Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC105371520 Gene

Subcategory (RNA class) for LOC105371520 Gene


Quality Score for this RNA gene is


Aliases for LOC105371520 Gene

  • Uncharacterized LOC105371520 3

External Ids for LOC105371520 Gene

Previous GeneCards Identifiers for LOC105371520 Gene

  • GC17U902162
  • GC17P008178
  • GC17P008303
  • GC17P008179
  • GC17P008240
  • GC17P008266
  • GC17P008286

Summaries for LOC105371520 Gene

GeneCards Summary for LOC105371520 Gene

LOC105371520 (Uncharacterized LOC105371520) is an RNA Gene, and is affiliated with the ncRNA class. Diseases associated with LOC105371520 include Leukoencephalopathy, Brain Calcifications, And Cysts and Orofaciodigital Syndrome Xvi.

Additional gene information for LOC105371520 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC105371520 Gene

Genomics for LOC105371520 Gene

GeneHancer (GH) Regulatory Elements for LOC105371520 Gene

Promoters and enhancers for LOC105371520 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC105371520 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105371520 Gene

Genomic Locations for LOC105371520 Gene
8,994 bases
Plus strand
1,357 bases
Plus strand

Genomic View for LOC105371520 Gene

Genes around LOC105371520 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105371520 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105371520 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105371520 Gene

Proteins for LOC105371520 Gene

Post-translational modifications for LOC105371520 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105371520 Gene

Domains & Families for LOC105371520 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC105371520 Gene

Function for LOC105371520 Gene

Phenotypes From GWAS Catalog for LOC105371520 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105371520 Gene

Localization for LOC105371520 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105371520 Gene

Pathways & Interactions for LOC105371520 Gene

PathCards logo

SuperPathways for LOC105371520 Gene

No Data Available

Interacting Proteins for LOC105371520 Gene

Gene Ontology (GO) - Biological Process for LOC105371520 Gene


No data available for Pathways by source and SIGNOR curated interactions for LOC105371520 Gene

Drugs & Compounds for LOC105371520 Gene

No Compound Related Data Available

Transcripts for LOC105371520 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105371520 Gene

No ASD Table

Relevant External Links for LOC105371520 Gene

GeneLoc Exon Structure for

No data available for mRNA/cDNA for LOC105371520 Gene

Expression for LOC105371520 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105371520 Gene

Orthologs for LOC105371520 Gene

No data available for Orthologs and Evolution for LOC105371520 Gene

Paralogs for LOC105371520 Gene

No data available for Paralogs for LOC105371520 Gene

Variants for LOC105371520 Gene

Sequence variations from dbSNP and Humsavar for LOC105371520 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1131692180 pathogenic, Meckel syndrome 13 8,175,756(+) C/T intron_variant
rs117735243 uncertain-significance, Leukoencephalopathy, brain calcifications, and cysts 8,173,586(+) G/A/C/T upstream_transcript_variant
rs1555525654 pathogenic, Leukoencephalopathy, brain calcifications, and cysts 8,173,567(+) AAGGATTATCCCACCTGACGATACAGACAAA/AAGGATTATCCCACCTGACGATACAGACAAAGGATTATCCCACCTGACGATACAGACAAA upstream_transcript_variant
rs1555525895 pathogenic, Meckel syndrome 13 8,174,242(+) T/ upstream_transcript_variant
rs1555526172 pathogenic, OROFACIODIGITAL SYNDROME XVI 8,175,980(+) T/C intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105371520 Gene

Disorders for LOC105371520 Gene

MalaCards: The human disease database

(3) MalaCards diseases for LOC105371520 Gene - From: GeneCards

- elite association - COSMIC cancer census association via MalaCards
genes like me logo Genes that share disorders with LOC105371520: view

No data available for UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105371520 Gene

Publications for LOC105371520 Gene

No publications were found for LOC105371520 Gene.

No data available for External Links for LOC105371520 Gene

Products for LOC105371520 Gene

Sources for LOC105371520 Gene

Loading form....