Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC105370515 Gene

Subcategory (RNA class) for LOC105370515 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC105370515 Gene

  • Uncharacterized LOC105370515 3
  • AL161757.2 5

External Ids for LOC105370515 Gene

Previous GeneCards Identifiers for LOC105370515 Gene

  • GC14U901858

Summaries for LOC105370515 Gene

GeneCards Summary for LOC105370515 Gene

LOC105370515 (Uncharacterized LOC105370515) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105370515 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC105370515 Gene

Genomics for LOC105370515 Gene

GeneHancer (GH) Regulatory Elements for LOC105370515 Gene

Promoters and enhancers for LOC105370515 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14J056648 Enhancer 0.4 ENCODE 650.7 +0.2 216 0.7 CREB1 EZH2 LOC105370515 LOC101927690 TMEM260
GH14J055802 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 31.2 +843.3 843266 6.3 PKNOX1 ATF1 FOXA2 BRCA1 YY1 GTF3C2 TCF12 GLIS2 GATA2 ATF7 LOC105370515 ATG14 MAPK1IP1L SOCS4 LINC00520 PIR35523
GH14J056578 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE 17.8 +68.5 68516 2.4 PKNOX1 CLOCK ARNT ARID4B SIN3A FEZF1 DMAP1 ZBTB7B YY1 POLR2B TMEM260 LOC105370515 PELI2 LOC101927690
GH14J056216 Enhancer 1.1 Ensembl ENCODE dbSUPER 20.2 +431.7 431712 1 MEIS2 GTF2F1 PKNOX1 NFATC3 NFIB TEAD4 NFXL1 CDC5L RAD21 POLR2B LOC105370515 TMEM260 PELI2 ATG14 ENSG00000275569 ENSG00000277763
GH14J057007 Enhancer 1.5 VISTA UCNEbase 10 -360.7 -360741 3.9 PKNOX1 ATF1 ARNT FEZF1 NCOA2 TCF12 GATA2 ZFP91 ATF7 GTF2B LOC105370515 LOC440180 RPL3P3 OTX2-AS1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC105370515 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105370515 Gene

Genomic Locations for LOC105370515 Gene
chr14:56,633,244-56,648,658
(GRCh38/hg38)
Size:
15,415 bases
Orientation:
Minus strand
chr14:57,099,962-57,115,376
(GRCh37/hg19)
Size:
15,415 bases
Orientation:
Minus strand

Genomic View for LOC105370515 Gene

Genes around LOC105370515 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105370515 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105370515 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105370515 Gene

Proteins for LOC105370515 Gene

Post-translational modifications for LOC105370515 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105370515 Gene

Domains & Families for LOC105370515 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC105370515 Gene

Function for LOC105370515 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105370515 Gene

Localization for LOC105370515 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105370515 Gene

Pathways & Interactions for LOC105370515 Gene

SuperPathways for LOC105370515 Gene

No Data Available

Interacting Proteins for LOC105370515 Gene

Gene Ontology (GO) - Biological Process for LOC105370515 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC105370515 Gene

Drugs & Compounds for LOC105370515 Gene

No Compound Related Data Available

Transcripts for LOC105370515 Gene

mRNA/cDNA for LOC105370515 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :
(2) RNA Central transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105370515 Gene

No ASD Table

Relevant External Links for LOC105370515 Gene

GeneLoc Exon Structure for
LOC105370515

Expression for LOC105370515 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105370515 Gene

Orthologs for LOC105370515 Gene

Evolution for LOC105370515 Gene

ENSEMBL:
Gene Tree for LOC105370515 (if available)
TreeFam:
Gene Tree for LOC105370515 (if available)

No data available for Orthologs for LOC105370515 Gene

Paralogs for LOC105370515 Gene

No data available for Paralogs for LOC105370515 Gene

Variants for LOC105370515 Gene

Sequence variations from dbSNP and Humsavar for LOC105370515 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs1085307449 pathogenic, Structural heart defects and renal anomalies syndrome 56,633,142(-) TATCTAT/TAT downstream_transcript_variant
rs1000013854 -- 56,639,255(-) AGGGTAACTACAGCCAACAA/A upstream_transcript_variant
rs1000207296 -- 56,635,406(-) C/T intron_variant
rs1000239277 -- 56,639,077(-) G/A upstream_transcript_variant
rs1000809525 -- 56,634,081(-) C/A intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105370515 Gene

Disorders for LOC105370515 Gene

No disorders were found for LOC105370515 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105370515 Gene

Publications for LOC105370515 Gene

No publications were found for LOC105370515 Gene.

Products for LOC105370515 Gene

Sources for LOC105370515 Gene

Content
Loading form....