Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC105369864 Gene

Subcategory (RNA class) for LOC105369864 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC105369864 Gene

  • Uncharacterized LOC105369864 3

External Ids for LOC105369864 Gene

Previous GeneCards Identifiers for LOC105369864 Gene

  • GC12U902299

Summaries for LOC105369864 Gene

GeneCards Summary for LOC105369864 Gene

LOC105369864 (Uncharacterized LOC105369864) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC105369864 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC105369864 Gene

Genomics for LOC105369864 Gene

GeneHancer (GH) Regulatory Elements for LOC105369864 Gene

Promoters and enhancers for LOC105369864 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12J079705 Enhancer 1 Ensembl ENCODE dbSUPER 0.4 -8.7 -8664 1.5 FOSL2 CTBP1 CEBPB EP300 ZNF217 DPF2 CUX1 GATAD2B GATA3 FOXA1 ENSG00000257894 LOC105369864 ENSG00000258048 PAWR
GH12J079725 Enhancer 0.7 Ensembl ENCODE 0.4 +10.9 10853 1.6 ATF7 CEBPB JUN JUND ATF2 FOS PAWR LOC105369864 ENSG00000258048 ENSG00000277130
GH12J079738 Enhancer 0.7 Ensembl 0.3 +23.1 23059 0.6 CTCF RAD21 KAT8 PKNOX1 RXRA GATAD2B CEBPA GATAD2A REST SP1 PAWR LOC105369864 ENSG00000258048 ENSG00000277130
GH12J079783 Enhancer 0.8 Ensembl ENCODE 0.2 +69.6 69628 2.1 MLLT1 MAFK EGR1 SMARCA4 DPF2 NFE2L2 POLR2A ZNF316 NFE2 MAFG ENSG00000277130 LOC105369864 PPP1R12A
GH12J079717 Enhancer 0.2 Ensembl 0.7 +2.1 2059 0.2 PAWR LOC105369864 ENSG00000258048 ENSG00000277130
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC105369864 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC105369864 Gene

Genomic Locations for LOC105369864 Gene
chr12:79,715,242-79,778,543
(GRCh38/hg38)
Size:
63,302 bases
Orientation:
Plus strand

Genomic View for LOC105369864 Gene

Genes around LOC105369864 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC105369864 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC105369864 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC105369864 Gene

Proteins for LOC105369864 Gene

Post-translational modifications for LOC105369864 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC105369864 Gene

Domains & Families for LOC105369864 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC105369864 Gene

Function for LOC105369864 Gene

Phenotypes From GWAS Catalog for LOC105369864 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC105369864 Gene

Localization for LOC105369864 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC105369864 Gene

Pathways & Interactions for LOC105369864 Gene

PathCards logo

SuperPathways for LOC105369864 Gene

No Data Available

Interacting Proteins for LOC105369864 Gene

Gene Ontology (GO) - Biological Process for LOC105369864 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC105369864 Gene

Drugs & Compounds for LOC105369864 Gene

No Compound Related Data Available

Transcripts for LOC105369864 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC105369864 Gene

No ASD Table

Relevant External Links for LOC105369864 Gene

GeneLoc Exon Structure for
LOC105369864

No data available for mRNA/cDNA for LOC105369864 Gene

Expression for LOC105369864 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC105369864 Gene

Orthologs for LOC105369864 Gene

No data available for Orthologs and Evolution for LOC105369864 Gene

Paralogs for LOC105369864 Gene

No data available for Paralogs for LOC105369864 Gene

Variants for LOC105369864 Gene

Sequence variations from dbSNP and Humsavar for LOC105369864 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs1000024011 -- 79,720,763(+) A/G intron_variant
rs1000029563 -- 79,762,817(+) C/A intron_variant
rs1000033839 -- 79,755,481(+) A/T intron_variant
rs1000051597 -- 79,720,422(+) A/T intron_variant
rs1000104773 -- 79,722,131(+) TTTCTCAGCCCCCATT/TTTCTCAGCCCCCATTTCTCAGCCCCCATT intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC105369864 Gene

Disorders for LOC105369864 Gene

No disorders were found for LOC105369864 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC105369864 Gene

Publications for LOC105369864 Gene

No publications were found for LOC105369864 Gene.

No data available for External Links for LOC105369864 Gene

Products for LOC105369864 Gene

Sources for LOC105369864 Gene

Content
Loading form....