Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC102725044 Gene

Subcategory (RNA class) for LOC102725044 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC102725044 Gene

  • Uncharacterized LOC102725044 3

External Ids for LOC102725044 Gene

Previous GeneCards Identifiers for LOC102725044 Gene

  • GC14U901455

Summaries for LOC102725044 Gene

GeneCards Summary for LOC102725044 Gene

LOC102725044 (Uncharacterized LOC102725044) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC102725044 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC102725044 Gene

Genomics for LOC102725044 Gene

GeneHancer (GH) Regulatory Elements for LOC102725044 Gene

Promoters and enhancers for LOC102725044 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14J024270 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE 600.7 +1.6 1598 5.4 ZNF652 SP1 CTCF ELF3 MNT CBFA2T2 ZNF148 NKRF POLR2A CEBPG RABGGTA LOC102725044 IPO4 TSSK4 RNF31 HOMEZ KHNYN NOP9 NGDN DHRS1
GH14J024298 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 0.3 +28.6 28573 2.8 ZNF652 ZFX SP1 ELF3 MNT SIX5 NKRF POLR2A CEBPG CSDE1 DHRS1 NOP9 LTB4R PIR40275 LOC102725044
GH14J024277 Enhancer 1 FANTOM5 ENCODE 0.4 +7.5 7484 3.1 ZNF687 RELA IKZF1 CREB1 IKZF2 ZNF143 CTCF EED ELF1 PKNOX1 PIR40275 DHRS1 TINF2 NOP9 NEDD8-MDP1 NEDD8 LTB4R2 LTB4R CIDEB MDP1
GH14J024295 Enhancer 1 ENCODE 0.3 +25.9 25949 2.4 ZNF652 CC2D1A ELF3 CTCF POLR2A CEBPG ZNF687 AHR TFE3 SP7 DHRS1 ENSG00000259321 RNA5SP383 TGM1 PIR40275 LOC102725044
GH14J024275 Enhancer 0.4 ENCODE 0.7 +4.5 4482 0.2 CTCF RAD21 L3MBTL2 TINF2 NEDD8 NEDD8-MDP1 DHRS1 NOP9 GMPR2 MDP1 CHMP4A ENSG00000254692 TM9SF1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC102725044 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC102725044 Gene

Genomic Locations for LOC102725044 Gene
chr14:24,271,228-24,298,653
(GRCh38/hg38)
Size:
27,426 bases
Orientation:
Plus strand

Genomic View for LOC102725044 Gene

Genes around LOC102725044 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC102725044 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC102725044 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC102725044 Gene

Proteins for LOC102725044 Gene

Post-translational modifications for LOC102725044 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC102725044 Gene

Domains & Families for LOC102725044 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC102725044 Gene

Function for LOC102725044 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC102725044 Gene

Localization for LOC102725044 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC102725044 Gene

Pathways & Interactions for LOC102725044 Gene

PathCards logo

SuperPathways for LOC102725044 Gene

No Data Available

Interacting Proteins for LOC102725044 Gene

Gene Ontology (GO) - Biological Process for LOC102725044 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC102725044 Gene

Drugs & Compounds for LOC102725044 Gene

No Compound Related Data Available

Transcripts for LOC102725044 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC102725044 Gene

No ASD Table

Relevant External Links for LOC102725044 Gene

GeneLoc Exon Structure for
LOC102725044

No data available for mRNA/cDNA for LOC102725044 Gene

Expression for LOC102725044 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC102725044 Gene

Orthologs for LOC102725044 Gene

No data available for Orthologs and Evolution for LOC102725044 Gene

Paralogs for LOC102725044 Gene

No data available for Paralogs for LOC102725044 Gene

Variants for LOC102725044 Gene

Sequence variations from dbSNP and Humsavar for LOC102725044 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs1000004430 -- 24,280,870(+) G/A genic_upstream_transcript_variant, intron_variant
rs1000065403 -- 24,290,707(+) CACCCCAGAACTCACC/CACCCCAGAACTCACCCCAGAACTCACC genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000119979 -- 24,280,612(+) G/A genic_upstream_transcript_variant, intron_variant
rs1000147165 -- 24,297,185(+) G/A intron_variant
rs1000414917 -- 24,277,653(+) A/C genic_upstream_transcript_variant, intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC102725044 Gene

Disorders for LOC102725044 Gene

No disorders were found for LOC102725044 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC102725044 Gene

Publications for LOC102725044 Gene

No publications were found for LOC102725044 Gene.

No data available for External Links for LOC102725044 Gene

Products for LOC102725044 Gene

Sources for LOC102725044 Gene

Content
Loading form....