Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC102724665 Gene

Aliases for LOC102724665 Gene

  • Putative Protein PRAC2 3

External Ids for LOC102724665 Gene

Previous GeneCards Identifiers for LOC102724665 Gene

  • GC06U902626

Summaries for LOC102724665 Gene

GeneCards Summary for LOC102724665 Gene

LOC102724665 (Putative Protein PRAC2) is a Protein Coding gene.

Additional gene information for LOC102724665 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC102724665 Gene

Genomics for LOC102724665 Gene

GeneHancer (GH) Regulatory Elements for LOC102724665 Gene

Promoters and enhancers for LOC102724665 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06J092631 Enhancer 0.2 Ensembl 0.4 +12.5 12504 1.4 LOC102724665 LOC105377896
GH06J092617 Enhancer 0.2 Ensembl 0.3 +26.8 26804 0.8 LOC102724665 LOC105377896
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC102724665 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC102724665 Gene

Genomic Locations for LOC102724665 Gene
333 bases
Minus strand

Genomic View for LOC102724665 Gene

Genes around LOC102724665 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC102724665 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC102724665 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC102724665 Gene

Proteins for LOC102724665 Gene

Post-translational modifications for LOC102724665 Gene

No Post-translational modifications

Other Protein References for LOC102724665 Gene

REFSEQ proteins:

No data available for DME Specific Peptides for LOC102724665 Gene

Domains & Families for LOC102724665 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC102724665 Gene

Function for LOC102724665 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC102724665 Gene

Localization for LOC102724665 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC102724665 Gene

Pathways & Interactions for LOC102724665 Gene

PathCards logo

SuperPathways for LOC102724665 Gene

No Data Available

Interacting Proteins for LOC102724665 Gene

Gene Ontology (GO) - Biological Process for LOC102724665 Gene


No data available for Pathways by source and SIGNOR curated interactions for LOC102724665 Gene

Drugs & Compounds for LOC102724665 Gene

No Compound Related Data Available

Transcripts for LOC102724665 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC102724665 Gene

No ASD Table

Relevant External Links for LOC102724665 Gene

GeneLoc Exon Structure for

No data available for mRNA/cDNA for LOC102724665 Gene

Expression for LOC102724665 Gene

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC102724665 Gene

Orthologs for LOC102724665 Gene

No data available for Orthologs and Evolution for LOC102724665 Gene

Paralogs for LOC102724665 Gene

No data available for Paralogs for LOC102724665 Gene

Variants for LOC102724665 Gene

Sequence variations from dbSNP and Humsavar for LOC102724665 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1001293285 -- 92,644,112(-) G/A downstream_transcript_variant
rs1001683849 -- 92,644,313(-) C/T 3_prime_UTR_variant
rs1001720336 -- 92,645,963(-) GATATACCTAATGCTAAATGACGA/GA upstream_transcript_variant
rs1001843911 -- 92,646,512(-) A/G upstream_transcript_variant
rs1003088906 -- 92,644,569(-) CCCC/CCC coding_sequence_variant, frameshift

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC102724665 Gene

Disorders for LOC102724665 Gene

No disorders were found for LOC102724665 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC102724665 Gene

Publications for LOC102724665 Gene

No publications were found for LOC102724665 Gene.

No data available for External Links for LOC102724665 Gene

Products for LOC102724665 Gene

Sources for LOC102724665 Gene

Loading form....