Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC102724596 Gene

Subcategory (RNA class) for LOC102724596 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC102724596 Gene

  • Uncharacterized LOC102724596 3

External Ids for LOC102724596 Gene

Summaries for LOC102724596 Gene

GeneCards Summary for LOC102724596 Gene

LOC102724596 (Uncharacterized LOC102724596) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC102724596 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC102724596 Gene

Genomics for LOC102724596 Gene

GeneHancer (GH) Regulatory Elements for LOC102724596 Gene

Promoters and enhancers for LOC102724596 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J049356 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 600.7 -1.2 -1232 6.7 ELF3 ZFX MNT CBFA2T2 ZNF148 NKRF MLLT1 ZNF121 ZNF384 ZNF687 ZNF652 ENSG00000248714 LOC102724596 PIR41840 ENSG00000262837 UBE2Z KAT7 FLJ40194 GC17M049339
GH17J049365 Enhancer 0.8 Ensembl ENCODE 0.7 +4.7 4707 1.1 MAFK MZF1 CTCF CTBP1 SMARCA5 PKNOX1 SIN3A RAD21 ZNF335 FOXA1 GC17P049366 ZNF652 ENSG00000248714 LOC102724596
GH17J049371 Promoter/Enhancer 0.7 Ensembl dbSUPER 0.4 +9.4 9436 0.4 ENSG00000262039 ZNF652 GC17P049368 LOC102724596
GH17J049370 Enhancer 0.7 ENCODE dbSUPER 0.4 +10.4 10429 1.3 SP1 EGR1 DPF2 ZFHX2 POLR2A EGR2 ENSG00000262039 ENSG00000186244 ENSG00000250186 PHB ZNF652 ENSG00000250948 LOC102724596
GH17J049379 Enhancer 0.8 Ensembl ENCODE 0.3 +20.0 20036 3.6 SP1 PRDM1 HES1 CEBPB NFIC CEBPG HNF4A KDM1A ZBTB7B RXRA ENSG00000250186 PHB ZNF652 FLJ40194 ENSG00000250948 ENSG00000262039 ENSG00000186244 RPL21P124 LOC102724596
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC102724596 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC102724596 Gene

Genomic Locations for LOC102724596 Gene
chr17:49,361,165-49,380,094
(GRCh38/hg38)
Size:
18,930 bases
Orientation:
Plus strand

Genomic View for LOC102724596 Gene

Genes around LOC102724596 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC102724596 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC102724596 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC102724596 Gene

Proteins for LOC102724596 Gene

Post-translational modifications for LOC102724596 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC102724596 Gene

Domains & Families for LOC102724596 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC102724596 Gene

Function for LOC102724596 Gene

Phenotypes From GWAS Catalog for LOC102724596 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC102724596 Gene

Localization for LOC102724596 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC102724596 Gene

Pathways & Interactions for LOC102724596 Gene

PathCards logo

SuperPathways for LOC102724596 Gene

No Data Available

Interacting Proteins for LOC102724596 Gene

Gene Ontology (GO) - Biological Process for LOC102724596 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC102724596 Gene

Drugs & Compounds for LOC102724596 Gene

No Compound Related Data Available

Transcripts for LOC102724596 Gene

mRNA/cDNA for LOC102724596 Gene

(4) Additional mRNA sequences :
(3) RNA Central transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for LOC102724596 Gene

No ASD Table

Relevant External Links for LOC102724596 Gene

GeneLoc Exon Structure for
LOC102724596

Expression for LOC102724596 Gene

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC102724596 Gene

Orthologs for LOC102724596 Gene

No data available for Orthologs and Evolution for LOC102724596 Gene

Paralogs for LOC102724596 Gene

No data available for Paralogs for LOC102724596 Gene

Variants for LOC102724596 Gene

Sequence variations from dbSNP and Humsavar for LOC102724596 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1000001677 -- 49,377,149(+) G/T genic_downstream_transcript_variant, intron_variant
rs1000019269 -- 49,368,315(+) G/T genic_downstream_transcript_variant, intron_variant
rs1000143947 -- 49,362,163(+) GCGGGGCGGGCAGCGCGGGGCGGGC/GCGGGGCGGGC/GCGGGGCGGGCAGCGCGGGGCGGGCAGCGCGGGGCGGGC genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000165408 -- 49,360,611(+) CGACGAC/CGAC upstream_transcript_variant
rs1000173596 -- 49,372,607(+) C/T genic_downstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for LOC102724596 Gene

Variant ID Type Subtype PubMed ID
nsv1112712 CNV deletion 24896259
nsv1118765 CNV deletion 24896259
nsv526307 CNV gain 19592680

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Variation tolerance and Additional Variant Information for LOC102724596 Gene

Disorders for LOC102724596 Gene

No disorders were found for LOC102724596 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC102724596 Gene

Publications for LOC102724596 Gene

  1. A genome-wide association meta-analysis of circulating sex hormone-binding globulin reveals multiple Loci implicated in sex steroid hormone regulation. (PMID: 22829776) Coviello AD … Perry JR (PLoS genetics 2012) 3 58
  2. Genome-wide association study of prostate cancer in men of African ancestry identifies a susceptibility locus at 17q21. (PMID: 21602798) Haiman CA … Henderson BE (Nature genetics 2011) 3 58
  3. Genome-wide association study identifies eight loci associated with blood pressure. (PMID: 19430483) Newton-Cheh C … Munroe PB (Nature genetics 2009) 3 58
  4. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K … Sugano S (Genome research 2006) 3 58

No data available for External Links for LOC102724596 Gene

Products for LOC102724596 Gene

Sources for LOC102724596 Gene

Content
Loading form....