Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC102723814 Gene

Subcategory (RNA class) for LOC102723814 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC102723814 Gene

  • Uncharacterized LOC102723814 3

External Ids for LOC102723814 Gene

Previous GeneCards Identifiers for LOC102723814 Gene

  • GC20U900828

Summaries for LOC102723814 Gene

GeneCards Summary for LOC102723814 Gene

LOC102723814 (Uncharacterized LOC102723814) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC102723814 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC102723814 Gene

Genomics for LOC102723814 Gene

GeneHancer (GH) Regulatory Elements for LOC102723814 Gene

Promoters and enhancers for LOC102723814 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH20J063519 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 600.7 -1.9 -1923 4.3 SP1 CC2D1A ZFX ZNF148 NKRF POLR2A ZNF687 MYC NCOA6 YY1 PPDPF LOC102723814 GC20M063514 DIDO1 UCKL1 GMEB2 CICP4 PRPF6 MIR647 RTEL1
GH20J063508 Enhancer 0.5 Ensembl dbSUPER 0.4 +10.8 10816 0.4 ZNF362 PIR50623 ENSG00000237371 LOC102723814
GH20J063510 Enhancer 0.3 Ensembl 0.4 +7.5 7516 2.2 PKNOX1 PIR50623 LOC102723814
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC102723814 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC102723814 Gene

Genomic Locations for LOC102723814 Gene
chr20:63,517,262-63,519,417
(GRCh38/hg38)
Size:
2,156 bases
Orientation:
Minus strand

Genomic View for LOC102723814 Gene

Genes around LOC102723814 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC102723814 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC102723814 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC102723814 Gene

Proteins for LOC102723814 Gene

Post-translational modifications for LOC102723814 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC102723814 Gene

Domains & Families for LOC102723814 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC102723814 Gene

Function for LOC102723814 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC102723814 Gene

Localization for LOC102723814 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC102723814 Gene

Pathways & Interactions for LOC102723814 Gene

PathCards logo

SuperPathways for LOC102723814 Gene

No Data Available

Interacting Proteins for LOC102723814 Gene

Gene Ontology (GO) - Biological Process for LOC102723814 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC102723814 Gene

Drugs & Compounds for LOC102723814 Gene

No Compound Related Data Available

Transcripts for LOC102723814 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC102723814 Gene

No ASD Table

Relevant External Links for LOC102723814 Gene

GeneLoc Exon Structure for
LOC102723814

No data available for mRNA/cDNA for LOC102723814 Gene

Expression for LOC102723814 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC102723814 Gene

Orthologs for LOC102723814 Gene

No data available for Orthologs and Evolution for LOC102723814 Gene

Paralogs for LOC102723814 Gene

No data available for Paralogs for LOC102723814 Gene

Variants for LOC102723814 Gene

Sequence variations from dbSNP and Humsavar for LOC102723814 Gene

SNP ID Clin Chr 20 pos Variation AA Info Type
rs1000105712 -- 63,519,296(-) T/A non_coding_transcript_variant
rs1000114418 -- 63,520,337(-) A/T upstream_transcript_variant
rs1000772055 -- 63,516,926(-) G/C downstream_transcript_variant
rs1000899026 -- 63,520,941(-) GGGGCGAGGGGCG/GGGGCGAGGGGCGAGGGGCG upstream_transcript_variant
rs1000910367 -- 63,521,075(-) G/C/T upstream_transcript_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC102723814 Gene

Disorders for LOC102723814 Gene

No disorders were found for LOC102723814 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC102723814 Gene

Publications for LOC102723814 Gene

No publications were found for LOC102723814 Gene.

No data available for External Links for LOC102723814 Gene

Products for LOC102723814 Gene

Sources for LOC102723814 Gene

Content
Loading form....