Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC102723321 Gene

Subcategory (RNA class) for LOC102723321 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC102723321 Gene

  • Uncharacterized LOC102723321 3

External Ids for LOC102723321 Gene

Previous GeneCards Identifiers for LOC102723321 Gene

  • GC01U904000

Summaries for LOC102723321 Gene

GeneCards Summary for LOC102723321 Gene

LOC102723321 (Uncharacterized LOC102723321) is an RNA Gene, and is affiliated with the ncRNA class. Diseases associated with LOC102723321 include Atrial Fibrillation, Familial, 11 and Atrial Standstill.

Additional gene information for LOC102723321 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC102723321 Gene

Genomics for LOC102723321 Gene

GeneHancer (GH) Regulatory Elements for LOC102723321 Gene

Promoters and enhancers for LOC102723321 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01J147699 Enhancer 0.7 ENCODE 600.7 -0.1 -86 1.4 CTCF RAD21 TRIM22 RCOR1 PKNOX1 YY1 RFX5 ZNF217 SMC3 NFIC LOC102723321 ACP6 ENSG00000234190 GJA5 GJA8 ENSG00000234225 ENSG00000227139 LOC105371230
GH01J147759 Promoter/Enhancer 1.7 EPDnew Ensembl ENCODE dbSUPER 0.2 +61.4 61417 4 PRDM1 MNT NR2F2 GATA3 GJA5 ACP6 ENSG00000272824 ENSG00000274415 ENSG00000234190 LOC102723321
GH01J147716 Enhancer 0.9 ENCODE 0.4 +17.0 17031 1.9 ELF3 CEBPG NFIB TFE3 ZNF644 FOSL2 CREB1 RFX1 SOX13 CEBPA ENSG00000234190 GJA5 ACP6 LOC102723321 LOC105371230
GH01J147721 Enhancer 0.9 Ensembl ENCODE 0.3 +22.3 22325 4.6 CTCF CEBPG ARID2 REST CTBP1 CEBPB SMARCA5 MAX ESRRA ZBTB17 ENSG00000234190 GJA5 ACP6 ENSG00000234225 LOC105371230 LOC102723321
GH01J147771 Promoter/Enhancer 1.6 EPDnew Ensembl dbSUPER 0.2 +72.1 72125 2.6 EGR1 PKNOX1 SCRT2 ZNF207 ZFHX2 FOS ZNF398 KLF1 EGR2 ACP6 ENSG00000234190 GJA5 ENSG00000274415 LOC102723321
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC102723321 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC102723321 Gene

Genomic Locations for LOC102723321 Gene
chr1:147,700,376-147,810,024
(GRCh38/hg38)
Size:
109,649 bases
Orientation:
Plus strand

Genomic View for LOC102723321 Gene

Genes around LOC102723321 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC102723321 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC102723321 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC102723321 Gene

Proteins for LOC102723321 Gene

Post-translational modifications for LOC102723321 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC102723321 Gene

Domains & Families for LOC102723321 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC102723321 Gene

Function for LOC102723321 Gene

Phenotypes From GWAS Catalog for LOC102723321 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC102723321 Gene

Localization for LOC102723321 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC102723321 Gene

Pathways & Interactions for LOC102723321 Gene

PathCards logo

SuperPathways for LOC102723321 Gene

No Data Available

Interacting Proteins for LOC102723321 Gene

Gene Ontology (GO) - Biological Process for LOC102723321 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC102723321 Gene

Drugs & Compounds for LOC102723321 Gene

No Compound Related Data Available

Transcripts for LOC102723321 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC102723321 Gene

No ASD Table

Relevant External Links for LOC102723321 Gene

GeneLoc Exon Structure for
LOC102723321

No data available for mRNA/cDNA for LOC102723321 Gene

Expression for LOC102723321 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC102723321 Gene

Orthologs for LOC102723321 Gene

No data available for Orthologs and Evolution for LOC102723321 Gene

Paralogs for LOC102723321 Gene

No data available for Paralogs for LOC102723321 Gene

Variants for LOC102723321 Gene

Sequence variations from dbSNP and Humsavar for LOC102723321 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs11267274 likely-benign, Familial atrial fibrillation 147,757,496(+) GGGCATTTGCCAGAGGTACATACCAGGGCATTTGCCAGAGGTACATACCA/GGGCATTTGCCAGAGGTACATACCA/GGGCATTTGCCAGAGGTACATACCAGGGCATTTGCCAGAGGTACATACCAGGGCATTTGCCAGAGGTACATACCA intron_variant
rs11552588 likely-benign, Familial atrial fibrillation 147,773,279(+) T/C intron_variant
rs116551187 uncertain-significance, Familial atrial fibrillation, Atrial fibrillation, familial, 11, Atrial standstill 1 147,758,244(+) C/T intron_variant
rs121434557 pathogenic, likely-pathogenic, Atrial fibrillation, familial, 11, not provided 147,758,953(+) C/A/T intron_variant
rs121434558 pathogenic, Atrial fibrillation, somatic 147,758,977(+) G/A intron_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC102723321 Gene

Disorders for LOC102723321 Gene

MalaCards: The human disease database

(4) MalaCards diseases for LOC102723321 Gene - From: GeneCards

Disorder Aliases PubMed IDs
atrial fibrillation, familial, 11
  • atfb11
atrial standstill
  • atrial cardiomyopathy with heart block
familial atrial fibrillation
  • atrial fibrillation, familial, 1
atrial standstill 1
  • atrst1
- elite association - COSMIC cancer census association via MalaCards
genes like me logo Genes that share disorders with LOC102723321: view

No data available for UniProtKB/Swiss-Prot , Genatlas and External Links for LOC102723321 Gene

Publications for LOC102723321 Gene

  1. Common genetic variation and performance on standardized cognitive tests. (PMID: 20125193) Cirulli ET … Goldstein DB (European journal of human genetics : EJHG 2010) 3 58

No data available for External Links for LOC102723321 Gene

Products for LOC102723321 Gene

Sources for LOC102723321 Gene

Content
Loading form....