Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC101929898 Gene

Subcategory (RNA class) for LOC101929898 Gene

ncRNA

Quality Score for this RNA gene is

13

Aliases for LOC101929898 Gene

  • Uncharacterized LOC101929898 3

External Ids for LOC101929898 Gene

Previous GeneCards Identifiers for LOC101929898 Gene

  • GC05U901784

Summaries for LOC101929898 Gene

GeneCards Summary for LOC101929898 Gene

LOC101929898 (Uncharacterized LOC101929898) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC101929898 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC101929898 Gene

Genomics for LOC101929898 Gene

GeneHancer (GH) Regulatory Elements for LOC101929898 Gene

Promoters and enhancers for LOC101929898 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05J000689 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 600.7 -0.8 -826 4.2 POLR2A GLIS2 ZBTB8A ZNF600 ZIC2 ZEB2 PATZ1 ZNF341 NRF1 ZBTB20 TPPP LOC101929898 ENSG00000250848 ENSG00000232615 ENSG00000271781 ZDHHC11 BRD9 PIR34715
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LOC101929898 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC101929898 Gene

Genomic Locations for LOC101929898 Gene
chr5:693,527-695,809
(GRCh38/hg38)
Size:
2,283 bases
Orientation:
Plus strand

Genomic View for LOC101929898 Gene

Genes around LOC101929898 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC101929898 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC101929898 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC101929898 Gene

Proteins for LOC101929898 Gene

Post-translational modifications for LOC101929898 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC101929898 Gene

Domains & Families for LOC101929898 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC101929898 Gene

Function for LOC101929898 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC101929898 Gene

Localization for LOC101929898 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC101929898 Gene

Pathways & Interactions for LOC101929898 Gene

PathCards logo

SuperPathways for LOC101929898 Gene

No Data Available

Interacting Proteins for LOC101929898 Gene

Gene Ontology (GO) - Biological Process for LOC101929898 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC101929898 Gene

Drugs & Compounds for LOC101929898 Gene

No Compound Related Data Available

Transcripts for LOC101929898 Gene

Alternative Splicing Database (ASD) splice patterns (SP) for LOC101929898 Gene

No ASD Table

Relevant External Links for LOC101929898 Gene

GeneLoc Exon Structure for
LOC101929898

No data available for mRNA/cDNA for LOC101929898 Gene

Expression for LOC101929898 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC101929898 Gene

Orthologs for LOC101929898 Gene

No data available for Orthologs and Evolution for LOC101929898 Gene

Paralogs for LOC101929898 Gene

No data available for Paralogs for LOC101929898 Gene

Variants for LOC101929898 Gene

Sequence variations from dbSNP and Humsavar for LOC101929898 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs1006040661 -- 692,949(+) G/A upstream_transcript_variant
rs1011854439 -- 693,744(+) C/G/T intron_variant
rs1012712608 -- 693,390(+) CCGCCCAGCCCCGCCCAGCCC/CCGCCCAGCCC/CCGCCCAGCCCCGCCCAGCCCCGCCCAGCCC upstream_transcript_variant
rs1012944838 -- 692,476(+) C/T upstream_transcript_variant
rs1016950063 -- 692,138(+) A/C upstream_transcript_variant

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) , Variation tolerance and Additional Variant Information for LOC101929898 Gene

Disorders for LOC101929898 Gene

No disorders were found for LOC101929898 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for LOC101929898 Gene

Publications for LOC101929898 Gene

No publications were found for LOC101929898 Gene.

No data available for External Links for LOC101929898 Gene

Products for LOC101929898 Gene

Sources for LOC101929898 Gene

Content
Loading form....