Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC100128770 Gene

Subcategory (RNA class) for LOC100128770 Gene


Quality Score for this RNA gene is


Aliases for LOC100128770 Gene

  • Uncharacterized LOC100128770 3
  • AC108134.1 5

External Ids for LOC100128770 Gene

Previous GeneCards Identifiers for LOC100128770 Gene

  • GC16P003022
  • GC16P003085
  • GC16P003086
  • GC16P003088
  • GC16P003089
  • GC16P003114
  • GC16P003129

Summaries for LOC100128770 Gene

GeneCards Summary for LOC100128770 Gene

LOC100128770 (Uncharacterized LOC100128770) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC100128770 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC100128770 Gene

Genomics for LOC100128770 Gene

GeneHancer (GH) Regulatory Elements for LOC100128770 Gene

Promoters and enhancers for LOC100128770 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16J003031 Enhancer 0.8 ENCODE 650.7 -0.7 -656 0.2 RB1 ARID4B SIN3A RAD21 RFX5 ZNF143 BCLAF1 DEK ZNF654 CEBPB LOC100128770 BICDL2 HCFC1R1
GH16J003035 Promoter/Enhancer 1.3 EPDnew Ensembl ENCODE 48.7 +3.8 3790 2.1 SMARCE1 MAZ SIN3A ELF1 KLF4 ZNF664 ZSCAN16 POLR2A EZH2 BICDL2 GC16M003037 LOC100128770 NLRC3
GH16J003037 Enhancer 0.7 ENCODE 42.8 +5.9 5890 0.9 BCOR SOX13 ZNF792 ZNF493 MAX ZMYM3 CEBPG ZFHX2 POLR2A SCRT2 PIR32172 GC16M003041 GC16M003037 BICDL2 LOC100128770 ZNF213-AS1 TSC2 ZNF75A TIGD7 ERVK13-1
GH16J003029 Enhancer 0.7 ENCODE 41.5 -2.8 -2796 0.1 ATF1 RB1 ARID4B CCNT2 CTBP1 POLR2A EGR1 CREM GATAD2A ZNF263 LOC100128770 E4F1 ENSG00000261938 CREBBP TSC2 LOC105371055 ERVK13-1 ZNF75A ZNF174 AMDHD2
GH16J003069 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 11.7 +41.9 41899 9.8 HDGF PKNOX1 YBX1 IRF4 ZNF207 ZNF143 ZFP91 ATF7 RUNX3 PAF1 GC16P003606 ZNF205 LOC105371058 MMP25 ZNF597 IL32 FLYWCH2 ZNF200 ZNF174 ZSCAN32
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around LOC100128770 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the LOC100128770 gene promoter:
  • AP-1
  • STAT3
  • c-Jun

Genomic Locations for LOC100128770 Gene

Genomic Locations for LOC100128770 Gene
6,653 bases
Plus strand
6,653 bases
Plus strand

Genomic View for LOC100128770 Gene

Genes around LOC100128770 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC100128770 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC100128770 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC100128770 Gene

Proteins for LOC100128770 Gene

Post-translational modifications for LOC100128770 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC100128770 Gene

Domains & Families for LOC100128770 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC100128770 Gene

Function for LOC100128770 Gene

Phenotypes From GWAS Catalog for LOC100128770 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC100128770 Gene

Localization for LOC100128770 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC100128770 Gene

Pathways & Interactions for LOC100128770 Gene

SuperPathways for LOC100128770 Gene

No Data Available

Interacting Proteins for LOC100128770 Gene

Gene Ontology (GO) - Biological Process for LOC100128770 Gene


No data available for Pathways by source and SIGNOR curated interactions for LOC100128770 Gene

Drugs & Compounds for LOC100128770 Gene

No Compound Related Data Available

Transcripts for LOC100128770 Gene

mRNA/cDNA for LOC100128770 Gene

(2) Additional mRNA sequences :
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :
(1) RNA Central transcripts :

Unigene Clusters for LOC100128770 Gene

Uncharacterized LOC100128770:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for LOC100128770 Gene

No ASD Table

Relevant External Links for LOC100128770 Gene

GeneLoc Exon Structure for

Expression for LOC100128770 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for LOC100128770 Gene

SOURCE GeneReport for Unigene cluster for LOC100128770 Gene:

genes like me logo Genes that share expression patterns with LOC100128770: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC100128770 Gene

Orthologs for LOC100128770 Gene

Evolution for LOC100128770 Gene

Gene Tree for LOC100128770 (if available)
Gene Tree for LOC100128770 (if available)

No data available for Orthologs for LOC100128770 Gene

Paralogs for LOC100128770 Gene

No data available for Paralogs for LOC100128770 Gene

Variants for LOC100128770 Gene

Sequence variations from dbSNP and Humsavar for LOC100128770 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs1000024355 -- 3,036,078(+) C/T non_coding_transcript_variant
rs1000028770 -- 3,032,511(+) C/T non_coding_transcript_variant
rs1000308899 -- 3,036,969(+) C/T intron_variant
rs1000447187 -- 3,032,401(+) C/T upstream_transcript_variant
rs1000525687 -- 3,036,758(+) CCGGCGCCCCCGGTTCCCCGGCG/CCGGCG non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for LOC100128770 Gene

Variant ID Type Subtype PubMed ID
nsv833125 CNV loss 17160897
nsv571248 CNV loss 21841781
nsv510673 CNV deletion 20534489
nsv509588 CNV insertion 20534489
esv3637645 CNV gain 21293372
esv2763127 CNV loss 21179565

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Variation tolerance and Additional Variant Information for LOC100128770 Gene

Disorders for LOC100128770 Gene

Additional Disease Information for LOC100128770

No disorders were found for LOC100128770 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LOC100128770 Gene

Publications for LOC100128770 Gene

No publications were found for LOC100128770 Gene.

Products for LOC100128770 Gene

Sources for LOC100128770 Gene

Loading form....