Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LOC100128593 Gene

Subcategory (RNA class) for LOC100128593 Gene

ncRNA

Quality Score for this RNA gene is

1

Aliases for LOC100128593 Gene

  • Uncharacterized LOC100128593 3

External Ids for LOC100128593 Gene

Previous GeneCards Identifiers for LOC100128593 Gene

  • GC09U901118
  • GC09P138762
  • GC09P139641

Summaries for LOC100128593 Gene

GeneCards Summary for LOC100128593 Gene

LOC100128593 (Uncharacterized LOC100128593) is an RNA Gene, and is affiliated with the ncRNA class.

Additional gene information for LOC100128593 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LOC100128593 Gene

Genomics for LOC100128593 Gene

GeneHancer (GH) Regulatory Elements for LOC100128593 Gene

Promoters and enhancers for LOC100128593 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09I136748 Promoter/Enhancer 0.7 EPDnew ENCODE 0.8 +2.9 2889 1.2 ENSG00000204003 LCN6 LCN8 LCN15 LOC100128593
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around LOC100128593 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LOC100128593 Gene

Genomic Locations for LOC100128593 Gene
chr9:136,746,161-136,749,911
(GRCh38/hg38)
Size:
3,751 bases
Orientation:
Plus strand
chr9:139,640,613-139,644,363
(GRCh37/hg19)

Genomic View for LOC100128593 Gene

Genes around LOC100128593 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LOC100128593 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LOC100128593 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LOC100128593 Gene

Proteins for LOC100128593 Gene

Post-translational modifications for LOC100128593 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LOC100128593 Gene

Domains & Families for LOC100128593 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LOC100128593 Gene

Function for LOC100128593 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LOC100128593 Gene

Localization for LOC100128593 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LOC100128593 Gene

Pathways & Interactions for LOC100128593 Gene

SuperPathways for LOC100128593 Gene

No Data Available

Interacting Proteins for LOC100128593 Gene

Gene Ontology (GO) - Biological Process for LOC100128593 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LOC100128593 Gene

Drugs & Compounds for LOC100128593 Gene

No Compound Related Data Available

Transcripts for LOC100128593 Gene

mRNA/cDNA for LOC100128593 Gene

(2) Additional mRNA sequences :

Unigene Clusters for LOC100128593 Gene

Uncharacterized LOC100128593:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for LOC100128593 Gene

No ASD Table

Relevant External Links for LOC100128593 Gene

GeneLoc Exon Structure for
LOC100128593

Expression for LOC100128593 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for LOC100128593 Gene

mRNA expression in normal human tissues for LOC100128593 Gene

SOURCE GeneReport for Unigene cluster for LOC100128593 Gene:

Hs.679904
genes like me logo Genes that share expression patterns with LOC100128593: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LOC100128593 Gene

Orthologs for LOC100128593 Gene

No data available for Orthologs and Evolution for LOC100128593 Gene

Paralogs for LOC100128593 Gene

No data available for Paralogs for LOC100128593 Gene

Variants for LOC100128593 Gene

Sequence variations from dbSNP and Humsavar for LOC100128593 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs1000540096 -- 136,747,040(+) G/C intron_variant
rs1001016722 -- 136,747,233(+) G/C non_coding_transcript_variant
rs1001710956 -- 136,747,303(+) G/A non_coding_transcript_variant
rs1002314179 -- 136,747,627(+) CCTCCAGCCTCAGCCTCCAGCCTC/CCTCCAGCCTC non_coding_transcript_variant
rs1002678168 -- 136,744,670(+) A/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for LOC100128593 Gene

Variant ID Type Subtype PubMed ID
esv2422220 CNV deletion 17116639
esv2657925 CNV deletion 23128226
esv2759720 CNV loss 17122850
esv3622013 CNV loss 21293372
esv3891732 CNV loss 25118596
nsv469918 CNV loss 18288195
nsv6769 CNV insertion 18451855
nsv818738 CNV gain 17921354
nsv8579 CNV gain 18304495
nsv951203 CNV deletion 24416366

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Variation tolerance and Additional Variant Information for LOC100128593 Gene

Disorders for LOC100128593 Gene

Additional Disease Information for LOC100128593

No disorders were found for LOC100128593 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LOC100128593 Gene

Publications for LOC100128593 Gene

No publications were found for LOC100128593 Gene.

Products for LOC100128593 Gene

Sources for LOC100128593 Gene

Content
Loading form....