Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LIPE-AS1 Gene

Subcategory (RNA class) for LIPE-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

13

Aliases for LIPE-AS1 Gene

  • LIPE Antisense RNA 1 2 3 5
  • CTB-50E14.6 3

External Ids for LIPE-AS1 Gene

Previous GeneCards Identifiers for LIPE-AS1 Gene

  • GC19P042903

Summaries for LIPE-AS1 Gene

GeneCards Summary for LIPE-AS1 Gene

LIPE-AS1 (LIPE Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for LIPE-AS1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LIPE-AS1 Gene

Genomics for LIPE-AS1 Gene

GeneHancer (GH) Regulatory Elements for LIPE-AS1 Gene

Promoters and enhancers for LIPE-AS1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19J042395 Promoter/Enhancer 1.7 Ensembl ENCODE dbSUPER 600.7 -0.1 -142 2.4 ZFX SP1 NKRF POLR2A GTF2F1 ZSCAN21 FOS ZBTB7A ELF1 SP7 LOC101930071 LIPE-AS1 ZNF526 ZNF574 ENSG00000269374 EXOSC5 CNFN
GH19J042398 Enhancer 0.3 FANTOM5 600.7 +1.8 1786 0.3 LIPE-AS1 LOC101930071 TMEM145 ENSG00000268605
GH19J042440 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.7 +46.1 46117 5.9 CTCF ELF3 CEBPG ZSCAN21 TFE3 SP1 PPARG CREM ZNF644 EGR1 CXCL17 ZNF574 ZNF526 LIPE-AS1 CNFN PSG8 ENSG00000268355 CD177 PIR51613
GH19J042183 Enhancer 1 ENCODE dbSUPER 10 -212.2 -212235 1.9 CTCF MAFK ELF1 RAD21 IKZF1 ZNF143 REST TRIM22 ZNF692 ZNF311 ENSG00000254887 DEDD2 ZNF526 LIPE-AS1 LIPE GRIK5 POU2F2 ENSG00000259436
GH19J042363 Enhancer 0.9 Ensembl ENCODE 11.1 -32.1 -32127 4.4 ZNF121 ZNF687 MLLT1 PRDM10 ZNF143 PKNOX1 KLF9 MGA RUNX3 ELF1 MEGF8 CNFN LIPE-AS1 LIPE GSK3A MIR8077 PIR47672 GC19P042378
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LIPE-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LIPE-AS1 Gene

Genomic Locations for LIPE-AS1 Gene
chr19:42,397,128-42,652,355
(GRCh38/hg38)
Size:
255,228 bases
Orientation:
Plus strand
chr19:42,901,280-43,156,507
(GRCh37/hg19)
Size:
255,228 bases
Orientation:
Plus strand

Genomic View for LIPE-AS1 Gene

Genes around LIPE-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LIPE-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LIPE-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LIPE-AS1 Gene

Proteins for LIPE-AS1 Gene

Post-translational modifications for LIPE-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LIPE-AS1 Gene

Domains & Families for LIPE-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LIPE-AS1 Gene

Function for LIPE-AS1 Gene

Phenotypes From GWAS Catalog for LIPE-AS1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LIPE-AS1 Gene

Localization for LIPE-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LIPE-AS1 Gene

Pathways & Interactions for LIPE-AS1 Gene

PathCards logo

SuperPathways for LIPE-AS1 Gene

No Data Available

Interacting Proteins for LIPE-AS1 Gene

Gene Ontology (GO) - Biological Process for LIPE-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LIPE-AS1 Gene

Drugs & Compounds for LIPE-AS1 Gene

No Compound Related Data Available

Transcripts for LIPE-AS1 Gene

mRNA/cDNA for LIPE-AS1 Gene

(6) Additional mRNA sequences :
(8) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
(10) RNA Central transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for LIPE-AS1 Gene

No ASD Table

Relevant External Links for LIPE-AS1 Gene

GeneLoc Exon Structure for
LIPE-AS1
ECgene alternative splicing isoforms for
LIPE-AS1

Expression for LIPE-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for LIPE-AS1 Gene

genes like me logo Genes that share expression patterns with LIPE-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LIPE-AS1 Gene

Orthologs for LIPE-AS1 Gene

Evolution for LIPE-AS1 Gene

ENSEMBL:
Gene Tree for LIPE-AS1 (if available)
TreeFam:
Gene Tree for LIPE-AS1 (if available)

No data available for Orthologs for LIPE-AS1 Gene

Paralogs for LIPE-AS1 Gene

No data available for Paralogs for LIPE-AS1 Gene

Variants for LIPE-AS1 Gene

Sequence variations from dbSNP and Humsavar for LIPE-AS1 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs587777699 likely-pathogenic, Familial partial lipodystrophy 6 42,401,822(+) CCCCCGCAGCCCCCGTCTACCCCCGCAGCCCCCGTCT/CCCCCGCAGCCCCCGTCT/CCCCCGCAGCCCCCGTCTACCCCCGCAGCCCCCGTCTACCCCCGCAGCCCCCGTCT genic_upstream_transcript_variant, intron_variant
rs766817317 pathogenic, Familial partial lipodystrophy 6 42,401,940(+) C/A/T genic_upstream_transcript_variant, intron_variant
rs34623222 likely-benign, not specified 42,410,613(+) G/A genic_upstream_transcript_variant, intron_variant
rs370837760 likely-benign, not specified 42,402,058(+) G/A genic_upstream_transcript_variant, intron_variant
rs112497256 uncertain-significance, not specified 42,410,728(+) C/A/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for LIPE-AS1 Gene

Variant ID Type Subtype PubMed ID
dgv15e196 CNV deletion 17116639
dgv6460n54 CNV loss 21841781
esv2422471 CNV deletion 17116639
esv2658409 CNV deletion 23128226
esv2673373 CNV deletion 23128226
esv2758763 CNV gain+loss 17122850
esv28684 CNV loss 19812545
esv32716 CNV gain 17666407
esv3583425 CNV loss 25503493
esv3644400 CNV loss 21293372
esv3644401 CNV loss 21293372
nsv1056270 CNV loss 25217958
nsv1058936 CNV gain 25217958
nsv1063042 CNV loss 25217958
nsv1064734 CNV gain 25217958
nsv482221 CNV gain 20164927
nsv520239 CNV loss 19592680
nsv522854 CNV gain 19592680
nsv526186 CNV gain 19592680
nsv579632 CNV gain 21841781
nsv579633 CNV loss 21841781
nsv953584 CNV deletion 24416366
nsv961222 CNV duplication 23825009
nsv961223 CNV duplication 23825009
nsv963054 CNV duplication 23825009
nsv963055 CNV duplication 23825009
nsv978823 CNV duplication 23825009

Additional Variant Information for LIPE-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
LIPE-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for LIPE-AS1 Gene

Disorders for LIPE-AS1 Gene

Additional Disease Information for LIPE-AS1

No disorders were found for LIPE-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LIPE-AS1 Gene

Publications for LIPE-AS1 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 58
  3. Normalization and subtraction: two approaches to facilitate gene discovery. (PMID: 8889548) Bonaldo MF … Soares MB (Genome research 1996) 3 58

Products for LIPE-AS1 Gene

Sources for LIPE-AS1 Gene

Content
Loading form....