Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LIPE Gene

Aliases for LIPE Gene

  • Lipase E, Hormone Sensitive Type 2 3 5
  • Lipase, Hormone-Sensitive 2 3
  • HSL 3 4
  • Hormone-Sensitive Lipase Testicular Isoform 3
  • Hormone-Sensitive Lipase 3
  • EC 4
  • AOMS4 3
  • FPLD6 3
  • LHS 3

External Ids for LIPE Gene

Previous GeneCards Identifiers for LIPE Gene

  • GC19M043552
  • GC19M043297
  • GC19M047581
  • GC19M047597
  • GC19M042906
  • GC19M039335

Summaries for LIPE Gene

Entrez Gene Summary for LIPE Gene

  • The protein encoded by this gene has a long and a short form, generated by use of alternative translational start codons. The long form is expressed in steroidogenic tissues such as testis, where it converts cholesteryl esters to free cholesterol for steroid hormone production. The short form is expressed in adipose tissue, among others, where it hydrolyzes stored triglycerides to free fatty acids. [provided by RefSeq, Jul 2008]

GeneCards Summary for LIPE Gene

LIPE (Lipase E, Hormone Sensitive Type) is a Protein Coding gene. Diseases associated with LIPE include Lipodystrophy, Familial Partial, Type 6 and Familial Partial Lipodystrophy. Among its related pathways are Apelin signaling pathway and Adipogenesis. Gene Ontology (GO) annotations related to this gene include protein kinase binding and triglyceride lipase activity.

UniProtKB/Swiss-Prot for LIPE Gene

  • In adipose tissue and heart, it primarily hydrolyzes stored triglycerides to free fatty acids, while in steroidogenic tissues, it principally converts cholesteryl esters to free cholesterol for steroid hormone production.

Gene Wiki entry for LIPE Gene

Additional gene information for LIPE Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LIPE Gene

Genomics for LIPE Gene

GeneHancer (GH) Regulatory Elements for LIPE Gene

Promoters and enhancers for LIPE Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19J042419 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 656 +4.9 4897 5.3 HDGF PKNOX1 ATF1 SMAD1 FOXA2 ARID4B SIN3A ZNF2 ZNF48 ZNF143 LIPE CD177 ENSG00000268605 LOC101930071 LIPE-AS1
GH19J042427 Promoter/Enhancer 0.7 EPDnew dbSUPER 650.7 +0.0 18 0.1 PIR52702 LIPE LIPE-AS1
GH19J042428 Enhancer 0.4 ENCODE dbSUPER 650.7 -0.1 -118 0.2 PIR52702 LIPE GC19P042435 LIPE-AS1
GH19J042449 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 22.1 -22.9 -22903 1.7 PKNOX1 FOXA2 SMAD1 MLX ARNT ARID4B DMAP1 IRF4 YY1 SLC30A9 LIPE CEACAMP1 CEACAMP10 PSG6 ZNF526 RNU4-60P PSG8 CD177 CEACAM1 CXCL17
GH19J042267 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 6.9 +156.5 156538 6.9 MLX FEZF1 YBX1 YY1 SLC30A9 E2F8 ZNF143 ZNF548 SP3 NFYC CIC PIR59110 ZNF526 ZNF574 CCDC97 DEDD2 MEGF8 CEACAM3 PAFAH1B3 PRR19
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LIPE on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the LIPE gene promoter:
  • PPAR-alpha
  • Sp1
  • ATF
  • Pax-4a
  • Evi-1
  • AML1a
  • c-Ets-1
  • p53

Genomic Locations for LIPE Gene

Genomic Locations for LIPE Gene
25,920 bases
Minus strand
25,920 bases
Minus strand

Genomic View for LIPE Gene

Genes around LIPE on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LIPE Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LIPE Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LIPE Gene

Proteins for LIPE Gene

  • Protein details for LIPE Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Hormone-sensitive lipase
    Protein Accession:
    Secondary Accessions:
    • Q3LRT2
    • Q6NSL7

    Protein attributes for LIPE Gene

    1076 amino acids
    Molecular mass:
    116598 Da
    Quaternary structure:
    • Interacts with CAVIN1 in the adipocyte cytoplasm (PubMed:17026959). Interacts with PLIN5 (By similarity).

    Alternative splice isoforms for LIPE Gene


neXtProt entry for LIPE Gene

Post-translational modifications for LIPE Gene

  • Phosphorylation by AMPK may block translocation to lipid droplets.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for LIPE Gene

Domains & Families for LIPE Gene

Gene Families for LIPE Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for LIPE Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the GDXG lipolytic enzyme family.
  • Belongs to the GDXG lipolytic enzyme family.
genes like me logo Genes that share domains with LIPE: view

Function for LIPE Gene

Molecular function for LIPE Gene

UniProtKB/Swiss-Prot Function:
In adipose tissue and heart, it primarily hydrolyzes stored triglycerides to free fatty acids, while in steroidogenic tissues, it principally converts cholesteryl esters to free cholesterol for steroid hormone production.
UniProtKB/Swiss-Prot CatalyticActivity:
Diacylglycerol + H(2)O = monoacylglycerol + a carboxylate.
UniProtKB/Swiss-Prot CatalyticActivity:
Triacylglycerol + H(2)O = diacylglycerol + a carboxylate.
UniProtKB/Swiss-Prot CatalyticActivity:
Monoacylglycerol + H(2)O = glycerol + a carboxylate.
UniProtKB/Swiss-Prot EnzymeRegulation:
Rapidly activated by cAMP-dependent phosphorylation under the influence of catecholamines. Dephosphorylation and inactivation are controlled by insulin.
GENATLAS Biochemistry:
lipase,hormone sensitive with two isoforms expressed in adipose tissue (HSLadi),testis (HSLtes),associated with obesity and non insulin dependent diabetes

Enzyme Numbers (IUBMB) for LIPE Gene

Gene Ontology (GO) - Molecular Function for LIPE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004806 triglyceride lipase activity IEA --
GO:0005515 protein binding IPI 17026959
GO:0016298 lipase activity IEA --
GO:0016787 hydrolase activity IEA --
GO:0017171 serine hydrolase activity IEA --
genes like me logo Genes that share ontologies with LIPE: view
genes like me logo Genes that share phenotypes with LIPE: view

Human Phenotype Ontology for LIPE Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for LIPE Gene

MGI Knock Outs for LIPE:

Animal Model Products

Clone Products

No data available for Phenotypes From GWAS Catalog , miRNA , Transcription Factor Targets and HOMER Transcription for LIPE Gene

Localization for LIPE Gene

Subcellular locations from UniProtKB/Swiss-Prot for LIPE Gene

Cell membrane. Membrane, caveola. Cytoplasm, cytosol. Note=Found in the high-density caveolae. Translocates to the cytoplasm from the caveolae upon insulin stimulation.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for LIPE gene
Compartment Confidence
plasma membrane 5
cytosol 5
nucleus 3
extracellular 2
mitochondrion 2
peroxisome 2
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for LIPE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005811 lipid droplet IEA,ISS --
GO:0005829 cytosol IDA --
GO:0005886 plasma membrane IEA --
GO:0005901 caveola IEA --
genes like me logo Genes that share ontologies with LIPE: view

Pathways & Interactions for LIPE Gene

genes like me logo Genes that share pathways with LIPE: view

UniProtKB/Swiss-Prot Q05469-LIPS_HUMAN

  • Pathway: Glycerolipid metabolism; triacylglycerol degradation.

SIGNOR curated interactions for LIPE Gene

Is inactivated by:

Gene Ontology (GO) - Biological Process for LIPE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006468 protein phosphorylation TAS 3420405
GO:0006629 lipid metabolic process IEA --
GO:0008152 metabolic process IEA --
GO:0008202 steroid metabolic process IEA --
GO:0008203 cholesterol metabolic process IEA --
genes like me logo Genes that share ontologies with LIPE: view

Drugs & Compounds for LIPE Gene

(37) Drugs for LIPE Gene - From: DGIdb, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Glycerol Approved, Investigational Pharma 175
Palmitic Acid Approved, Experimental Pharma Full agonist, Agonist 23
Stearic acid Approved, Experimental Pharma 0
Water Approved Pharma 0
cyclic amp Experimental Pharma 0

(99) Additional Compounds for LIPE Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • 2-(5Z,8Z,11Z,14Z-Eicosatetraenoyl)-glycerol
  • 2-AG
  • 2-Ara-GL
  • 2-Arachidonoyl-glycerol
  • 2-Arachidonyl-glycerol
Arachidic acid
  • Arachidinic acid
  • Arachinsaeure
  • C20:0
  • CH3-[CH2]18-COOH
  • Eicosanoic acid
Diglycerides Group A
  • 1-Myristoyl-2-eicosadienoyl-sn-glycerol
  • DAG(14:0/20:2)
  • DAG(14:0/20:2N6)
  • DAG(14:0/20:2W6)
  • DAG(34:2)
Diglycerides Group B
  • 1-(9Z-Octadecenoyl)-2-hexadecanoyl-sn-glycerol
  • 1-O-Oleoyl-2-O-palmitoyl-sn-glycerol
  • DG (18:1(9Z)/16:0/0:0)
  • DG(18:1/16:0)
  • Diglyceride
Diglycerides Group C
  • (2R)-2-Hydroxy-3-(pentadecanoyloxy)propyl (11Z,14Z)-icosa-11,14-dienoic acid
  • DAG(15:0/0:0/20:2w6)
  • Diacylglycerol(15:0/0:0/20:2w6)
  • Diacylglycerol(15:0/0:0/20:2)
  • DAG(15:0/0:0/20:2n6)
genes like me logo Genes that share compounds with LIPE: view

Transcripts for LIPE Gene

Unigene Clusters for LIPE Gene

Lipase, hormone-sensitive:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for LIPE Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8 ^ 9 ^ 10a · 10b ^ 11a · 11b · 11c ^ 12 ^ 13a · 13b · 13c ^ 14
SP1: - - -
SP2: -
SP3: -
SP6: - - - -
SP8: - - - -
SP9: - - -
SP10: -

Relevant External Links for LIPE Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for LIPE Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for LIPE Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for LIPE Gene

This gene is overexpressed in Adipose - Subcutaneous (x14.8), Adipose - Visceral (Omentum) (x11.2), and Breast - Mammary Tissue (x7.7).

Protein differential expression in normal tissues from HIPED for LIPE Gene

This gene is overexpressed in Adipocyte (47.7) and Nasopharynx (19.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for LIPE Gene

NURSA nuclear receptor signaling pathways regulating expression of LIPE Gene:


SOURCE GeneReport for Unigene cluster for LIPE Gene:


Evidence on tissue expression from TISSUES for LIPE Gene

  • Nervous system(3.7)
  • Muscle(2.5)
  • Adrenal gland(2.2)
  • Blood(2.2)
  • Liver(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for LIPE Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • reproductive
  • skeletal muscle
  • skeleton
Head and neck:
  • ear
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
  • chest wall
  • clavicle
  • heart
  • rib
  • rib cage
  • scapula
  • sternum
  • intestine
  • liver
  • pancreas
  • small intestine
  • ovary
  • pelvis
  • uterus
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • skin
  • spinal column
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with LIPE: view

No data available for Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for LIPE Gene

Orthologs for LIPE Gene

This gene was present in the common ancestor of animals.

Orthologs for LIPE Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia LIPE 34 33
  • 99.26 (n)
(Bos Taurus)
Mammalia LIPE 33
  • 86.17 (n)
HSL 34
  • 86 (a)
(Canis familiaris)
Mammalia LIPE 33
  • 83.98 (n)
HSL 34
  • 80 (a)
(Mus musculus)
Mammalia Lipe 16 34 33
  • 81.96 (n)
(Rattus norvegicus)
Mammalia Lipe 33
  • 78.08 (n)
(Monodelphis domestica)
Mammalia LIPE 34
  • 53 (a)
(Ornithorhynchus anatinus)
Mammalia LIPE 34
  • 48 (a)
(Anolis carolinensis)
Reptilia LIPE 34
  • 65 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia lipe 33
  • 62.34 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.18619 33
(Danio rerio)
Actinopterygii lipeb 34 33
  • 61.53 (n)
lipea 34
  • 53 (a)
Dr.14982 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.13588 33
fruit fly
(Drosophila melanogaster)
Insecta CG11055 34 35
  • 28 (a)
(Caenorhabditis elegans)
Secernentea C46C11.1 35
  • 33 (a)
hosl-1 34
  • 24 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 51 (a)
CSA.8706 34
  • 26 (a)
Species where no ortholog for LIPE was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for LIPE Gene

Gene Tree for LIPE (if available)
Gene Tree for LIPE (if available)
Evolutionary constrained regions (ECRs) for LIPE: view image

Paralogs for LIPE Gene

No data available for Paralogs for LIPE Gene

Variants for LIPE Gene

Sequence variations from dbSNP and Humsavar for LIPE Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs587777699 conflicting-interpretations-of-pathogenicity, Familial partial lipodystrophy 6 42,401,822(-) CCCCCGCAGCCCCCGTCTACCCCCGCAGCCCCCGTCT/CCCCCGCAGCCCCCGTCT coding_sequence_variant, frameshift
VAR_036539 A breast cancer sample p.Pro146Gln
rs34623222 likely-benign, not specified 42,410,613(-) G/A coding_sequence_variant, synonymous_variant
rs370837760 likely-benign, not specified 42,402,058(-) G/A coding_sequence_variant, synonymous_variant
rs112497256 uncertain-significance, not specified 42,410,728(-) C/A/T coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for LIPE Gene

Variant ID Type Subtype PubMed ID
dgv6460n54 CNV loss 21841781
esv2422471 CNV deletion 17116639
nsv520239 CNV loss 19592680
nsv522854 CNV gain 19592680
nsv526186 CNV gain 19592680
nsv579632 CNV gain 21841781
nsv579633 CNV loss 21841781
nsv953584 CNV deletion 24416366

Variation tolerance for LIPE Gene

Residual Variation Intolerance Score: 83.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.72; 73.20% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for LIPE Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for LIPE Gene

Disorders for LIPE Gene

MalaCards: The human disease database

(8) MalaCards diseases for LIPE Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
lipodystrophy, familial partial, type 6
  • fpld6
familial partial lipodystrophy
  • dunnigan syndrome
  • benign symmetrical lipomatosis
lipomatosis, multiple symmetric
  • msl
congenital epulis
  • congenital epulides
- elite association - COSMIC cancer census association via MalaCards
Search LIPE in MalaCards View complete list of genes associated with diseases


  • Lipodystrophy, familial partial, 6 (FPLD6) [MIM:615980]: A form of lipodystrophy characterized by abnormal subcutaneous fat distribution. Affected individuals have increased visceral fat, impaired lipolysis, dyslipidemia, hepatic steatosis, systemic insulin resistance, and diabetes. Some patients manifest muscular dystrophy. {ECO:0000269 PubMed:24848981}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for LIPE

genes like me logo Genes that share disorders with LIPE: view

No data available for Genatlas for LIPE Gene

Publications for LIPE Gene

  1. Gene organization and primary structure of human hormone-sensitive lipase: possible significance of a sequence homology with a lipase of Moraxella TA144, an antarctic bacterium. (PMID: 8506334) Langin D … Holm C (Proceedings of the National Academy of Sciences of the United States of America 1993) 2 3 4 22 58
  2. Blunted beta-adrenoceptor-mediated fat oxidation in overweight subjects: a role for the hormone-sensitive lipase gene. (PMID: 18249203) Jocken JW … Saris WH (Metabolism: clinical and experimental 2008) 3 22 44 58
  3. The combination of ApoCIII, hepatic lipase and hormono sensitive lipase gene polymorphisms suggests an association with susceptibility to gestational hypertension. (PMID: 17318300) Bernard N … Giguère Y (Journal of human genetics 2007) 3 22 44 58
  4. Association and insulin regulated translocation of hormone-sensitive lipase with PTRF. (PMID: 17026959) Aboulaich N … Strålfors P (Biochemical and biophysical research communications 2006) 3 4 22 58
  5. Investigation into the role of the hormone sensitive lipase -60C>G promoter variant in morbid obesity. (PMID: 15871848) Talmud PJ … Beisiegel U (Nutrition, metabolism, and cardiovascular diseases : NMCD 2005) 3 22 44 58

Products for LIPE Gene