Aliases for LINC01977 Gene

Subcategory (RNA class) for LINC01977 Gene

lncRNA

Quality Score for this RNA gene is

15

Aliases for LINC01977 Gene

  • Long Intergenic Non-Protein Coding RNA 1977 2 3 5
  • LINC01977 2 170
  • NONHSAG022925 94
  • HSALNG0119134 169
  • Lnc-CBX2-6 170

External Ids for LINC01977 Gene

Summaries for LINC01977 Gene

GeneCards Summary for LINC01977 Gene

LINC01977 (Long Intergenic Non-Protein Coding RNA 1977) is an RNA Gene, and is affiliated with the lncRNA class.

Additional gene information for LINC01977 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for LINC01977 Gene

Genomics for LINC01977 Gene

GeneHancer (GH) Regulatory Elements for LINC01977 Gene

Promoters and enhancers for LINC01977 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J079813 Promoter/Enhancer 1 CraniofacialAtlas dbSUPER 750.6 -1.3 -1318 0.2 POLR2A ZNF148 ZFX ZNF639 ZBTB8A ZEB2 PATZ1 ZBTB20 EZH2 ZBTB11 LINC01977 piR-33272 lnc-CBX8-1 CBX8
GH17J079814 Enhancer 0.8 ENCODE dbSUPER 750.6 +0.3 297 0.8 MYC HDGF IKZF1 TARDBP ZFX EZH2 USF1 ZNF592 DPF2 ZNF217 LINC01977 LOC102723961 piR-33272 CBX8
GH17J079809 Promoter/Enhancer 1.7 FANTOM5 ENCODE CraniofacialAtlas dbSUPER 0.6 -4.3 -4326 1 ZNF785 ZBTB40 SMARCE1 NFYC POLR2A ZKSCAN8 ZNF148 GTF2F1 ZFX AHR EIF4A3 ENSG00000262768 CBX8 ENDOV USP36 CCDC40 ENGASE CBX2 LINC01977 lnc-CBX8-1
GH17J079812 Enhancer 1.2 ENCODE dbSUPER 0.6 -2.4 -2410 2 CTCF RBPJ L3MBTL2 RAD21 POLR2A ZNF148 ELF3 SP7 ZSCAN21 PRDM1 LINC01977 lnc-CBX8-1 CBX8
GH17J079802 Promoter/Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 0.4 -11.7 -11664 0.5 SMARCE1 ELF1 L3MBTL2 TEAD4 GTF2F1 CSDE1 ZFX CBFA2T2 SMARCA4 ZNF639 CBX8 lnc-CBX8-1 CCDC40 LINC01977
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LINC01977 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LINC01977 Gene

Genomic Locations for LINC01977 Gene
chr17:79,814,620-79,827,704
(GRCh38/hg38)
Size:
13,085 bases
Orientation:
Plus strand
chr17:77,797,251-77,801,503
(GRCh37/hg19)
Size:
4,253 bases
Orientation:
Plus strand

Genomic View for LINC01977 Gene

Genes around LINC01977 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LINC01977 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LINC01977 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LINC01977 Gene

Proteins for LINC01977 Gene

Post-translational modifications for LINC01977 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LINC01977 Gene

Domains & Families for LINC01977 Gene

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for LINC01977 Gene

Function for LINC01977 Gene

Phenotypes From GWAS Catalog for LINC01977 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LINC01977 Gene

Localization for LINC01977 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LINC01977 Gene

Pathways & Interactions for LINC01977 Gene

PathCards logo

SuperPathways for LINC01977 Gene

No Data Available

Gene Ontology (GO) - Biological Process for LINC01977 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LINC01977 Gene

Drugs & Compounds for LINC01977 Gene

No Compound Related Data Available

Transcripts for LINC01977 Gene

mRNA/cDNA for LINC01977 Gene

(1) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
(10) RNACentral transcripts :
(6) LNCipedia transcripts :
(8) NONCODE transcripts :
(5) LncBook transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for LINC01977 Gene

No ASD Table

Relevant External Links for LINC01977 Gene

GeneLoc Exon Structure for
LINC01977
ECgene alternative splicing isoforms for
LINC01977

Expression for LINC01977 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LINC01977 Gene

Orthologs for LINC01977 Gene

Evolution for LINC01977 Gene

ENSEMBL:
Gene Tree for LINC01977 (if available)
TreeFam:
Gene Tree for LINC01977 (if available)

No data available for Orthologs for LINC01977 Gene

Paralogs for LINC01977 Gene

No data available for Paralogs for LINC01977 Gene

Variants for LINC01977 Gene

Sequence variations from dbSNP and Humsavar for LINC01977 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1000735038 -- 79,824,752(+) G/A intron_variant
rs1001012614 -- 79,825,327(+) A/G intron_variant
rs1002325157 -- 79,825,149(+) C/T intron_variant
rs1002854706 -- 79,827,442(+) CATGCACACACGCACACACATGCACACAC/CATGCACACAC non_coding_transcript_variant
rs1002917267 -- 79,826,456(+) C/T non_coding_transcript_variant

Additional Variant Information for LINC01977 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
LINC01977

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for LINC01977 Gene

Disorders for LINC01977 Gene

Additional Disease Information for LINC01977

No disorders were found for LINC01977 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LINC01977 Gene

Publications for LINC01977 Gene

  1. Transcriptome analysis of human gastric cancer. (PMID: 16341674) Oh JH … Kim NS (Mammalian genome : official journal of the International Mammalian Genome Society 2005) 3 56
  2. Normalization and subtraction: two approaches to facilitate gene discovery. (PMID: 8889548) Bonaldo MF … Soares MB (Genome research 1996) 3 56

Products for LINC01977 Gene

Sources for LINC01977 Gene