Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LINC01560 Gene

Subcategory (RNA class) for LINC01560 Gene

non-coding RNA

Quality Score for this RNA gene is

13

Aliases for LINC01560 Gene

  • Long Intergenic Non-Protein Coding RNA 1560 2 3 5
  • CXorf24 3 4
  • Putative Uncharacterized Protein Encoded By LINC01560 4
  • Chromosome X Open Reading Frame 24 2

External Ids for LINC01560 Gene

Previous HGNC Symbols for LINC01560 Gene

  • CXorf24

Summaries for LINC01560 Gene

GeneCards Summary for LINC01560 Gene

LINC01560 (Long Intergenic Non-Protein Coding RNA 1560) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with LINC01560 include Syndromic X-Linked Intellectual Disability.

Additional gene information for LINC01560 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LINC01560 Gene

Genomics for LINC01560 Gene

GeneHancer (GH) Regulatory Elements for LINC01560 Gene

Promoters and enhancers for LINC01560 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH0XJ047482 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 605.9 +0.7 685 4 ZNF652 ZFX ZNF148 NKRF ZNF121 ZSCAN21 NCOA6 YY1 SP7 ELF1 LINC01560 ZNF41 TIMP1 ELK1 GC0XP047511
GH0XJ047216 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 31 -264.1 -264112 5.2 HDGF SP1 ZFX SIX5 NKRF POLR2A MLLT1 GTF2F1 ZNF687 ZSCAN21 LOC105373194 CDK16 ENSG00000224072 ZNF81 ZNF182 INE1 LINC01560 ZNF674-AS1 UBA1 RBM10
GH0XJ046544 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 28.5 -936.2 -936240 4.6 ZFX ELF3 NKRF POLR2A MLLT1 CEBPG GTF2F1 ZNF687 ZSCAN21 ZBTB7A ZNF674-AS1 ZNF674 CHST7 ENSG00000224072 LINC01560 INE1 SLC9A7 NUS1P1 ZNF41 KRBOX4
GH0XJ047619 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 14 +137.2 137185 1.8 ZKSCAN8 SIX5 ZNF148 NKRF ZSCAN21 AHR TFE3 NCOA6 ZBTB7A PPARG SYN1 LINC01560 FTSJ1 ZNF182 RBM10 UBA1 UXT-AS1 ENSG00000283743
GH0XJ047512 Promoter/Enhancer 1.7 EPDnew Ensembl dbSUPER 13.5 +30.7 30685 2 YY1 ZNF600 PRDM10 CEBPA PATZ1 ZNF501 NR2C1 CEBPB ZBTB20 ZXDB ZNF41 GC0XP047512 NUS1P1 GC0XP047511 LINC01560 ENSG00000232009 SNORA11C INE1 UBA1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LINC01560 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LINC01560 Gene

Genomic Locations for LINC01560 Gene
chrX:47,482,716-47,485,227
(GRCh38/hg38)
Size:
2,512 bases
Orientation:
Plus strand
chrX:47,333,966-47,344,207
(GRCh37/hg19)
Size:
10,242 bases
Orientation:
Plus strand

Genomic View for LINC01560 Gene

Genes around LINC01560 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LINC01560 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LINC01560 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LINC01560 Gene

Proteins for LINC01560 Gene

  • Protein details for LINC01560 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8TB33-CX024_HUMAN
    Recommended name:
    Putative uncharacterized protein encoded by LINC01560
    Protein Accession:
    Q8TB33
    Secondary Accessions:
    • Q5H9B1

    Protein attributes for LINC01560 Gene

    Size:
    94 amino acids
    Molecular mass:
    10359 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AAH25179.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for LINC01560 Gene

Post-translational modifications for LINC01560 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LINC01560 Gene

Domains & Families for LINC01560 Gene

Protein Domains for LINC01560 Gene

ProtoNet:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with LINC01560: view

No data available for Gene Families , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LINC01560 Gene

Function for LINC01560 Gene

Phenotypes for LINC01560 Gene

genes like me logo Genes that share phenotypes with LINC01560: view

Animal Model Products

CRISPR Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for LINC01560 Gene

Localization for LINC01560 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LINC01560 Gene

Pathways & Interactions for LINC01560 Gene

PathCards logo

SuperPathways for LINC01560 Gene

No Data Available

Interacting Proteins for LINC01560 Gene

Gene Ontology (GO) - Biological Process for LINC01560 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LINC01560 Gene

Drugs & Compounds for LINC01560 Gene

No Compound Related Data Available

Transcripts for LINC01560 Gene

mRNA/cDNA for LINC01560 Gene

(5) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
(3) RNA Central transcripts :

CRISPR Products

Alternative Splicing Database (ASD) splice patterns (SP) for LINC01560 Gene

No ASD Table

Relevant External Links for LINC01560 Gene

GeneLoc Exon Structure for
LINC01560
ECgene alternative splicing isoforms for
LINC01560

Expression for LINC01560 Gene

Protein differential expression in normal tissues from HIPED for LINC01560 Gene

This gene is overexpressed in Fetal ovary (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for LINC01560 Gene



Protein tissue co-expression partners for LINC01560 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of LINC01560 Gene:

LINC01560

Evidence on tissue expression from TISSUES for LINC01560 Gene

  • Lung(2.9)
  • Intestine(2.4)
  • Nervous system(2)

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for LINC01560 Gene

Orthologs for LINC01560 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for LINC01560 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CXorf24 35
  • 100 (a)
OneToOne
Species where no ortholog for LINC01560 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for LINC01560 Gene

ENSEMBL:
Gene Tree for LINC01560 (if available)
TreeFam:
Gene Tree for LINC01560 (if available)

Paralogs for LINC01560 Gene

No data available for Paralogs for LINC01560 Gene

Variants for LINC01560 Gene

Sequence variations from dbSNP and Humsavar for LINC01560 Gene

SNP ID Clin Chr 0X pos Variation AA Info Type
rs1025319944 uncertain-significance, Non-syndromic X-linked intellectual disability 47,482,693(+) G/A upstream_transcript_variant
rs200168272 uncertain-significance, Non-syndromic X-linked intellectual disability 47,482,601(+) GCGTGCGCGTGCGCGTG/GCGTGCGCGTGCGCGTGCGCGTG upstream_transcript_variant
rs372112867 uncertain-significance, Non-syndromic X-linked intellectual disability 47,482,601(+) GCGTGCGCG/GCGTGCGCGCGCGTGCGCG/GCGTGCGCGCGCGTGCGCGTGCGCG upstream_transcript_variant
rs754233603 uncertain-significance, Non-syndromic X-linked intellectual disability 47,482,709(+) C/A upstream_transcript_variant
rs980619364 uncertain-significance, Non-syndromic X-linked intellectual disability 47,482,726(+) G/A/C non_coding_transcript_variant

Variation tolerance for LINC01560 Gene

Gene Damage Index Score: 5.06; 68.84% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for LINC01560 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
LINC01560

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for LINC01560 Gene

Disorders for LINC01560 Gene

MalaCards: The human disease database

(1) MalaCards diseases for LINC01560 Gene - From: GeneCards

Disorder Aliases PubMed IDs
syndromic x-linked intellectual disability
  • syndromic intellectual disability, x-linked
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for LINC01560

genes like me logo Genes that share disorders with LINC01560: view

No data available for UniProtKB/Swiss-Prot and Genatlas for LINC01560 Gene

Publications for LINC01560 Gene

  1. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 2 3 58
  2. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K … Sugano S (Genome research 2006) 3 58
  3. The DNA sequence of the human X chromosome. (PMID: 15772651) Ross MT … Bentley DR (Nature 2005) 4 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 4 58

Products for LINC01560 Gene

Sources for LINC01560 Gene

Content
Loading form....