Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LINC01391 Gene

Subcategory (RNA class) for LINC01391 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for LINC01391 Gene

  • Long Intergenic Non-Protein Coding RNA 1391 2 3 5

External Ids for LINC01391 Gene

Summaries for LINC01391 Gene

GeneCards Summary for LINC01391 Gene

LINC01391 (Long Intergenic Non-Protein Coding RNA 1391) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for LINC01391 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LINC01391 Gene

Genomics for LINC01391 Gene

GeneHancer (GH) Regulatory Elements for LINC01391 Gene

Promoters and enhancers for LINC01391 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03I138942 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE dbSUPER 550.8 -1.3 -1269 6.1 HDGF SMAD1 ATF1 POLR2B ZNF766 FOS ATF7 REST SMARCB1 ZNF592 FOXL2 FOXL2NB LINC01391 DBR1 DZIP1L ENSG00000272656 CEP70 ACTG1P1 COPB2 MRAS
GH03I138914 Enhancer 1.5 FANTOM5 Ensembl ENCODE 11.2 +28.2 28165 2.5 HDGF FOXA2 ARNT ARID4B SIN3A DMAP1 ZBTB7B YY1 SLC30A9 ZNF766 CEP70 PIK3CB FAIM LINC01391 FOXL2 FOXL2NB ATP5MC1P3
GH03I138923 Enhancer 1 Ensembl ENCODE 11.6 +20.4 20350 0.3 MEIS2 CTCF PKNOX1 RB1 ARID4B CEBPG ZNF2 ZNF48 RAD21 RFX5 FOXL2 FOXL2NB LINC01391 CEP70 FAIM ATP5MC1P3
GH03I138941 Enhancer 0.8 ENCODE dbSUPER 0.8 +2.5 2506 0.2 CTCF STAT1 RB1 REST RAD21 SP1 MTA3 SKIL CTBP1 IKZF1 CEP70 LINC01391 ATP5MC1P3
GH03I138935 Enhancer 1.3 Ensembl ENCODE dbSUPER 0.4 +7.8 7789 1.4 HDGF CLOCK ATF1 ZFP64 SIN3A ZNF2 ZNF48 ZNF143 ATF7 RUNX3 CEP70 LINC01391 ATP5MC1P3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around LINC01391 on UCSC Golden Path with GeneCards custom track

Genomic Locations for LINC01391 Gene

Genomic Locations for LINC01391 Gene
chr3:138,935,189-138,944,020
(GRCh38/hg38)
Size:
8,832 bases
Orientation:
Minus strand
chr3:138,654,031-138,662,862
(GRCh37/hg19)

Genomic View for LINC01391 Gene

Genes around LINC01391 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LINC01391 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LINC01391 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LINC01391 Gene

Proteins for LINC01391 Gene

Post-translational modifications for LINC01391 Gene

No Post-translational modifications

No data available for DME Specific Peptides for LINC01391 Gene

Domains & Families for LINC01391 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for LINC01391 Gene

Function for LINC01391 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for LINC01391 Gene

Localization for LINC01391 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for LINC01391 Gene

Pathways & Interactions for LINC01391 Gene

SuperPathways for LINC01391 Gene

No Data Available

Interacting Proteins for LINC01391 Gene

Gene Ontology (GO) - Biological Process for LINC01391 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for LINC01391 Gene

Drugs & Compounds for LINC01391 Gene

No Compound Related Data Available

Transcripts for LINC01391 Gene

mRNA/cDNA for LINC01391 Gene

(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for LINC01391 Gene

No ASD Table

Relevant External Links for LINC01391 Gene

GeneLoc Exon Structure for
LINC01391
ECgene alternative splicing isoforms for
LINC01391

Expression for LINC01391 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for LINC01391 Gene

NURSA nuclear receptor signaling pathways regulating expression of LINC01391 Gene:

LINC01391
genes like me logo Genes that share expression patterns with LINC01391: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for LINC01391 Gene

Orthologs for LINC01391 Gene

Evolution for LINC01391 Gene

ENSEMBL:
Gene Tree for LINC01391 (if available)
TreeFam:
Gene Tree for LINC01391 (if available)

No data available for Orthologs for LINC01391 Gene

Paralogs for LINC01391 Gene

No data available for Paralogs for LINC01391 Gene

Variants for LINC01391 Gene

Sequence variations from dbSNP and Humsavar for LINC01391 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs104893738 pathogenic, Blepharophimosis, ptosis, and epicanthus inversus syndrome type 1, Blepharophimosis, ptosis, and epicanthus inversus syndrome type 2 138,945,901(-) G/C upstream_transcript_variant
rs1057516173 pathogenic, Blepharophimosis, ptosis, and epicanthus inversus 138,946,020(-) CCGCGGCTGCAGCCGCAGCTGCTGCAGCCGC/CCGCGGCTGCAGCCGCAGCTGCTGCAGCCGCCGCGGCTGCAGCCGCAGCTGCTGCAGCCGC upstream_transcript_variant
rs1057516174 pathogenic, Blepharophimosis, ptosis, and epicanthus inversus 138,946,018(-) GCCCGCGGCTGCAGCCGCAGCTGCTGCAGCC/GCC upstream_transcript_variant
rs1057516175 pathogenic, Blepharophimosis, ptosis, and epicanthus inversus 138,945,974(-) CCC/C upstream_transcript_variant
rs1057516176 pathogenic, Blepharophimosis, ptosis, and epicanthus inversus 138,945,946(-) T/TT upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for LINC01391 Gene

Variant ID Type Subtype PubMed ID
dgv4908n100 CNV gain 25217958
nsv591854 CNV gain 21841781

Additional Variant Information for LINC01391 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
LINC01391

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for LINC01391 Gene

Disorders for LINC01391 Gene

Additional Disease Information for LINC01391

No disorders were found for LINC01391 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LINC01391 Gene

Publications for LINC01391 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58

Products for LINC01391 Gene

Sources for LINC01391 Gene

Content
Loading form....