Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LAPTM4B Gene

Aliases for LAPTM4B Gene

  • Lysosomal Protein Transmembrane 4 Beta 2 3 5
  • Lysosome-Associated Transmembrane Protein 4-Beta 3 4
  • Lysosomal Associated Protein Transmembrane 4 Beta 3
  • Lysosomal-Associated Transmembrane Protein 4B 3
  • LAPTM4beta 3
  • LC27 3

External Ids for LAPTM4B Gene

Previous GeneCards Identifiers for LAPTM4B Gene

  • GC08P098861
  • GC08P098457
  • GC08P098744
  • GC08P098856
  • GC08P093993
  • GC08P098787

Summaries for LAPTM4B Gene

GeneCards Summary for LAPTM4B Gene

LAPTM4B (Lysosomal Protein Transmembrane 4 Beta) is a Protein Coding gene. Among its related pathways are Lysosome. An important paralog of this gene is LAPTM4A.

UniProtKB/Swiss-Prot for LAPTM4B Gene

  • Required for optimal lysosomal function (PubMed:21224396). Blocks EGF-stimulated EGFR intraluminal sorting and degradation. Conversely by binding with the phosphatidylinositol 4,5-bisphosphate, regulates its PIP5K1C interaction, inhibits HGS ubiquitination and relieves LAPTM4B inhibition of EGFR degradation (PubMed:25588945). Recruits SLC3A2 and SLC7A5 (the Leu transporter) to the lysosome, promoting entry of leucine and other essential amino acid (EAA) into the lysosome, stimulating activation of proton-transporting vacuolar (V)-ATPase protein pump (V-ATPase) and hence mTORC1 activation (PubMed:25998567). Plays a role as negative regulator of TGFB1 production in regulatory T cells (PubMed:26126825). Binds ceramide and facilitates its exit from late endosome in order to control cell death pathways (PubMed:26280656).

Gene Wiki entry for LAPTM4B Gene

Additional gene information for LAPTM4B Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LAPTM4B Gene

Genomics for LAPTM4B Gene

GeneHancer (GH) Regulatory Elements for LAPTM4B Gene

Promoters and enhancers for LAPTM4B Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH08J097774 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 663.8 +2.1 2116 5 PKNOX1 ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 POLR2B ZNF766 SP3 LAPTM4B ENSG00000245970 POP1 MTDH ENSG00000270682
GH08J097830 Enhancer 1 FANTOM5 ENCODE 30.1 +56.4 56430 2 HDGF NCOA3 PKNOX1 SUZ12 NFIB NEUROD1 BMI1 ZBTB7B ZKSCAN1 MTA3 LAPTM4B ENSG00000245970 RPL30 MATN2 ENSG00000202399 RPS23P1 SNORA72 ERICH5 POP1 PIR33604
GH08J097798 Enhancer 1.1 Ensembl ENCODE dbSUPER 19.5 +23.9 23875 2.7 HDAC1 MEIS2 ATF1 CEBPG FOSL1 NCOR1 FOSL2 FOS ZNF600 CREM LAPTM4B MATN2 ENSG00000270682 PIR33604
GH08J097642 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 10 -129.7 -129713 5.3 HDGF PKNOX1 CLOCK FOXA2 ZFP64 ARID4B SIN3A DMAP1 ZNF2 ZBTB7B MTDH ENSG00000245970 ENSG00000202399 LAPTM4B GC08P097773
GH08J097846 Enhancer 0.6 ENCODE 26.1 +72.4 72402 1.3 PKNOX1 CBFB JUN NR2F1 JUNB MEF2B ELF1 BATF ATF2 IKZF1 GC08M097844 LAPTM4B ENSG00000202399 ERICH5 MATN2 GC08M097854
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LAPTM4B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the LAPTM4B gene promoter:
  • Lmo2
  • Pax-3
  • Brachyury
  • E4BP4
  • MEF-2A
  • aMEF-2
  • RORalpha1
  • E2F
  • E2F-1
  • GATA-1

Genomic Locations for LAPTM4B Gene

Genomic Locations for LAPTM4B Gene
chr8:97,775,057-97,853,013
(GRCh38/hg38)
Size:
77,957 bases
Orientation:
Plus strand
chr8:98,787,285-98,865,241
(GRCh37/hg19)
Size:
77,957 bases
Orientation:
Plus strand

Genomic View for LAPTM4B Gene

Genes around LAPTM4B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LAPTM4B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LAPTM4B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LAPTM4B Gene

Proteins for LAPTM4B Gene

  • Protein details for LAPTM4B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q86VI4-LAP4B_HUMAN
    Recommended name:
    Lysosomal-associated transmembrane protein 4B
    Protein Accession:
    Q86VI4
    Secondary Accessions:
    • Q3ZCV5
    • Q7L909
    • Q86VH8
    • Q9H060

    Protein attributes for LAPTM4B Gene

    Size:
    370 amino acids
    Molecular mass:
    41146 Da
    Quaternary structure:
    • Homooligomer; upon reaching the lysosomes (PubMed:21224396). Interacts with MCOLN1 (PubMed:21224396). Interacts with NEDD4; may play a role in the lysosomal sorting of LAPTM4B; enhances HGS association with NEDD4; mediates inhibition of EGFR degradation (PubMed:22096579, PubMed:25588945). Interacts with PIP5K1C; promotes SNX5 association with LAPTM4B; kinase activity of PIP5K1C is required; interaction is regulated by phosphatidylinositol 4,5-bisphosphate generated by PIP5K1C (PubMed:25588945). Interacts with HGS; promotes HGS ubiquitination (PubMed:25588945). Interacts with SNX5 (PubMed:25588945). Interacts with SLC3A2 AND SLC7A5; recruits SLC3A2 and SLC7A5 to lysosomes to promote leucine uptake into these organelles and is required for mTORC1 activation (PubMed:25998567). Interacts with LRRC32; decreases TGFB1 production in regulatory T cells (PubMed:26126825). Interacts with BECN1; competes with EGFR for LAPTM4B binding; regulates EGFR activity (PubMed:28479384). Interacts with EGFR; positively correlates with EGFR activation (PubMed:28479384).
    SequenceCaution:
    • Sequence=CAB66876.2; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for LAPTM4B Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for LAPTM4B Gene

Post-translational modifications for LAPTM4B Gene

Other Protein References for LAPTM4B Gene

No data available for DME Specific Peptides for LAPTM4B Gene

Domains & Families for LAPTM4B Gene

Gene Families for LAPTM4B Gene

Human Protein Atlas (HPA):
  • Predicted membrane proteins
  • Transporters

Protein Domains for LAPTM4B Gene

Graphical View of Domain Structure for InterPro Entry

Q86VI4

UniProtKB/Swiss-Prot:

LAP4B_HUMAN :
  • Belongs to the LAPTM4/LAPTM5 transporter family.
Family:
  • Belongs to the LAPTM4/LAPTM5 transporter family.
genes like me logo Genes that share domains with LAPTM4B: view

Function for LAPTM4B Gene

Molecular function for LAPTM4B Gene

UniProtKB/Swiss-Prot Function:
Required for optimal lysosomal function (PubMed:21224396). Blocks EGF-stimulated EGFR intraluminal sorting and degradation. Conversely by binding with the phosphatidylinositol 4,5-bisphosphate, regulates its PIP5K1C interaction, inhibits HGS ubiquitination and relieves LAPTM4B inhibition of EGFR degradation (PubMed:25588945). Recruits SLC3A2 and SLC7A5 (the Leu transporter) to the lysosome, promoting entry of leucine and other essential amino acid (EAA) into the lysosome, stimulating activation of proton-transporting vacuolar (V)-ATPase protein pump (V-ATPase) and hence mTORC1 activation (PubMed:25998567). Plays a role as negative regulator of TGFB1 production in regulatory T cells (PubMed:26126825). Binds ceramide and facilitates its exit from late endosome in order to control cell death pathways (PubMed:26280656).

Phenotypes From GWAS Catalog for LAPTM4B Gene

Gene Ontology (GO) - Molecular Function for LAPTM4B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 20711237
GO:0019900 kinase binding IPI 25588945
GO:0031625 ubiquitin protein ligase binding IPI 25588945
GO:0097001 ceramide binding IDA 26280656
GO:1902936 phosphatidylinositol bisphosphate binding IDA 25588945
genes like me logo Genes that share ontologies with LAPTM4B: view
genes like me logo Genes that share phenotypes with LAPTM4B: view

Animal Models for LAPTM4B Gene

MGI Knock Outs for LAPTM4B:
  • Laptm4b Laptm4b<tm1e.1(KOMP)Wtsi>

Animal Model Products

  • Taconic Biosciences Mouse Models for LAPTM4B

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for LAPTM4B Gene

Localization for LAPTM4B Gene

Subcellular locations from UniProtKB/Swiss-Prot for LAPTM4B Gene

Endomembrane system; Multi-pass membrane protein. Late endosome membrane. Cell membrane. Cell projection. Lysosome membrane. Endosome membrane. Endosome, multivesicular body membrane. Endosome, multivesicular body lumen.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for LAPTM4B gene
Compartment Confidence
plasma membrane 5
lysosome 5
endosome 5
nucleus 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for LAPTM4B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005764 lysosome IDA,IEA 25588945
GO:0005765 lysosomal membrane IEA,IDA 21224396
GO:0005768 endosome IDA,IEA 25588945
GO:0005769 early endosome IDA 25588945
GO:0005886 plasma membrane IDA,IEA 22096579
genes like me logo Genes that share ontologies with LAPTM4B: view

Pathways & Interactions for LAPTM4B Gene

SuperPathways for LAPTM4B Gene

SuperPathway Contained pathways
1 Lysosome
genes like me logo Genes that share pathways with LAPTM4B: view

Pathways by source for LAPTM4B Gene

1 KEGG pathway for LAPTM4B Gene

Gene Ontology (GO) - Biological Process for LAPTM4B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007032 endosome organization IMP 21224396
GO:0032509 endosome transport via multivesicular body sorting pathway IDA 25588945
GO:0032911 negative regulation of transforming growth factor beta1 production IDA 26126825
GO:0097213 regulation of lysosomal membrane permeability IMP 26280656
GO:1905166 negative regulation of lysosomal protein catabolic process IMP 25588945
genes like me logo Genes that share ontologies with LAPTM4B: view

No data available for SIGNOR curated interactions for LAPTM4B Gene

Drugs & Compounds for LAPTM4B Gene

No Compound Related Data Available

Transcripts for LAPTM4B Gene

mRNA/cDNA for LAPTM4B Gene

(1) REFSEQ mRNAs :
(10) Additional mRNA sequences :
(858) Selected AceView cDNA sequences:
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for LAPTM4B Gene

Lysosomal protein transmembrane 4 beta:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for LAPTM4B Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b
SP1:
SP2: - - - - -

Relevant External Links for LAPTM4B Gene

GeneLoc Exon Structure for
LAPTM4B
ECgene alternative splicing isoforms for
LAPTM4B

Expression for LAPTM4B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for LAPTM4B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for LAPTM4B Gene

This gene is overexpressed in Heart - Left Ventricle (x5.3) and Heart - Atrial Appendage (x4.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for LAPTM4B Gene



NURSA nuclear receptor signaling pathways regulating expression of LAPTM4B Gene:

LAPTM4B

SOURCE GeneReport for Unigene cluster for LAPTM4B Gene:

Hs.492314

Evidence on tissue expression from TISSUES for LAPTM4B Gene

  • Nervous system(4.9)
  • Eye(4.8)
  • Lung(4.7)
  • Skin(3.3)
  • Kidney(3)
  • Intestine(2.9)
  • Heart(2.8)
  • Pancreas(2.7)
  • Liver(2.4)
  • Stomach(2.2)
  • Lymph node(2)
genes like me logo Genes that share expression patterns with LAPTM4B: view

No data available for Protein differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for LAPTM4B Gene

Orthologs for LAPTM4B Gene

This gene was present in the common ancestor of animals.

Orthologs for LAPTM4B Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia LAPTM4B 34 33
  • 99.05 (n)
OneToOne
dog
(Canis familiaris)
Mammalia LAPTM4B 34 33
  • 91.59 (n)
OneToOne
cow
(Bos Taurus)
Mammalia LAPTM4B 34 33
  • 91.15 (n)
OneToMany
-- 34
  • 74 (a)
OneToMany
mouse
(Mus musculus)
Mammalia Laptm4b 16 34 33
  • 88.64 (n)
rat
(Rattus norvegicus)
Mammalia Laptm4b 33
  • 87.32 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia LAPTM4B 34
  • 84 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia LAPTM4B 34
  • 80 (a)
OneToOne
chicken
(Gallus gallus)
Aves LAPTM4B 34 33
  • 77.87 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia LAPTM4B 34
  • 66 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia laptm4b 33
  • 76.15 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.17780 33
zebrafish
(Danio rerio)
Actinopterygii laptm4b 34 33 33
  • 68.91 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG14767 34
  • 15 (a)
OneToMany
Species where no ortholog for LAPTM4B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for LAPTM4B Gene

ENSEMBL:
Gene Tree for LAPTM4B (if available)
TreeFam:
Gene Tree for LAPTM4B (if available)
Aminode:
Evolutionary constrained regions (ECRs) for LAPTM4B: view image

Paralogs for LAPTM4B Gene

Paralogs for LAPTM4B Gene

(2) SIMAP similar genes for LAPTM4B Gene using alignment to 3 proteins:

  • LAP4B_HUMAN
  • H0YBN1_HUMAN
  • Q86SJ0_HUMAN

Pseudogenes.org Pseudogenes for LAPTM4B Gene

genes like me logo Genes that share paralogs with LAPTM4B: view

Variants for LAPTM4B Gene

Sequence variations from dbSNP and Humsavar for LAPTM4B Gene

SNP ID Clin Chr 08 pos Variation AA Info Type
rs764278197 benign, not specified 97,775,938(+) GGCGGGCTCCAGGCGAGGCGG/GGCGGGCTCCAGGCGAGGCGGGCTCCAGGCGAGGCGG/GGCGGGCTCCAGGCGAGGCGGGCTCCAGGCGAGGCGGGCTCCAGGCGAGGCGG coding_sequence_variant, frameshift
rs1000044533 -- 97,788,474(+) C/T intron_variant
rs1000056402 -- 97,776,407(+) C/G/T intron_variant
rs1000059421 -- 97,789,579(+) G/A intron_variant
rs1000061901 -- 97,804,325(+) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for LAPTM4B Gene

Variant ID Type Subtype PubMed ID
esv23644 CNV loss 19812545
esv2658992 CNV deletion 23128226
esv2666910 CNV deletion 23128226
esv2737346 CNV deletion 23290073
esv3618141 CNV loss 21293372
esv3618142 CNV loss 21293372
nsv1017596 CNV gain 25217958
nsv1018567 CNV gain 25217958
nsv1116574 OTHER inversion 24896259
nsv1140922 CNV deletion 24896259
nsv517493 CNV loss 19592680
nsv526913 CNV loss 19592680
nsv971687 CNV duplication 23825009
nsv971688 CNV duplication 23825009

Variation tolerance for LAPTM4B Gene

Residual Variation Intolerance Score: 83% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.79; 47.35% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for LAPTM4B Gene

Human Gene Mutation Database (HGMD)
LAPTM4B
SNPedia medical, phenotypic, and genealogical associations of SNPs for
LAPTM4B

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for LAPTM4B Gene

Disorders for LAPTM4B Gene

Additional Disease Information for LAPTM4B

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for LAPTM4B Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for LAPTM4B Gene

Publications for LAPTM4B Gene

  1. Relationship between LAPTM4B gene polymorphism and susceptibility of colorectal and esophageal cancers. (PMID: 17965115) Cheng XJ … Zhou RL (Annals of oncology : official journal of the European Society for Medical Oncology 2008) 3 22 44 58
  2. Molecular cloning and characterization of LAPTM4B, a novel gene upregulated in hepatocellular carcinoma. (PMID: 12902989) Shao GZ … Ye DX (Oncogene 2003) 3 4 22 58
  3. Beclin1 antagonizes LAPTM4B-mediated EGFR overactivation in gastric cancer cells. (PMID: 28479384) Tian M … Li J (Gene 2017) 3 4 58
  4. LAPTM4B facilitates late endosomal ceramide export to control cell death pathways. (PMID: 26280656) Blom T … Ikonen E (Nature chemical biology 2015) 3 4 58
  5. Lysosomal-associated Transmembrane Protein 4B (LAPTM4B) Decreases Transforming Growth Factor β1 (TGF-β1) Production in Human Regulatory T Cells. (PMID: 26126825) Huygens C … Lucas S (The Journal of biological chemistry 2015) 3 4 58

Products for LAPTM4B Gene

Sources for LAPTM4B Gene

Content
Loading form....