Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KY Gene

Aliases for KY Gene

  • Kyphoscoliosis Peptidase 2 3 3 5
  • EC 3.4.-.- 4
  • MFM7 3

External Ids for KY Gene

Previous GeneCards Identifiers for KY Gene

  • GC03M135644
  • GC03M135804
  • GC03M134318
  • GC03M131695

Summaries for KY Gene

Entrez Gene Summary for KY Gene

  • The protein encoded by this gene belongs to the transglutaminase-like superfamily. The protein is involved in the function, maturation and stabilization of the neuromuscular junction and may be required for normal muscle growth. Mutations in this gene are associated with myopathy, myofibrillar, 7. [provided by RefSeq, Apr 2017]

GeneCards Summary for KY Gene

KY (Kyphoscoliosis Peptidase) is a Protein Coding gene. Diseases associated with KY include Myopathy, Myofibrillar, 7 and Kyphoscoliosis-Lateral Tongue Atrophy-Hereditary Spastic Paraplegia Syndrome. Gene Ontology (GO) annotations related to this gene include peptidase activity.

UniProtKB/Swiss-Prot for KY Gene

  • Probable cytoskeleton-associated protease required for normal muscle growth. Involved in function, maturation and stabilization of the neuromuscular junction. May act by cleaving muscle-specific proteins such as FLNC (By similarity).

Additional gene information for KY Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KY Gene

Genomics for KY Gene

GeneHancer (GH) Regulatory Elements for KY Gene

Promoters and enhancers for KY Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J134650 Promoter/Enhancer 1.7 EPDnew Ensembl ENCODE dbSUPER 650.7 +0.4 365 2.1 CTCF SUZ12 POLR2A GLIS1 MAFK EZH2 KY ANAPC13 GC03M134600 EPHB1
GH03J134685 Enhancer 0.5 ENCODE dbSUPER 11.5 -34.7 -34701 1.4 FOS KY EPHB1 CEP63 RNU6-1174P
GH03J134590 Enhancer 0.2 FANTOM5 10.7 +60.6 60557 0.4 ANAPC13 CEP63 KY EPHB1 GC03P134564 PIR32535
GH03J134662 Enhancer 0.6 ENCODE dbSUPER 0.4 -12.5 -12487 2.8 ZFHX2 HLF EGR2 ANAPC13 EPHB1 KY RNU6-1174P
GH03J134644 Enhancer 0.4 ENCODE 0.4 +6.4 6394 2.1 POLR2A REST RFX5 ANAPC13 CEP63 KY GC03M134600 EPHB1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around KY on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KY gene promoter:
  • Bach1
  • MIF-1
  • MyoD
  • c-Myb
  • E47
  • Tal-1
  • JunB
  • AP-1

Genomic Locations for KY Gene

Genomic Locations for KY Gene
chr3:134,599,923-134,651,677
(GRCh38/hg38)
Size:
51,755 bases
Orientation:
Minus strand
chr3:134,318,765-134,370,478
(GRCh37/hg19)
Size:
51,714 bases
Orientation:
Minus strand

Genomic View for KY Gene

Genes around KY on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KY Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KY Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KY Gene

Proteins for KY Gene

  • Protein details for KY Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8NBH2-KY_HUMAN
    Recommended name:
    Kyphoscoliosis peptidase
    Protein Accession:
    Q8NBH2
    Secondary Accessions:
    • B7Z1S4
    • Q6ZT15

    Protein attributes for KY Gene

    Size:
    561 amino acids
    Molecular mass:
    63855 Da
    Quaternary structure:
    • Interacts with IGFN1 and FLNC.

    Alternative splice isoforms for KY Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for KY Gene

Post-translational modifications for KY Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for KY Gene

Domains & Families for KY Gene

Gene Families for KY Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for KY Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for KY Gene

Graphical View of Domain Structure for InterPro Entry

Q8NBH2

UniProtKB/Swiss-Prot:

KY_HUMAN :
  • Belongs to the transglutaminase-like superfamily.
Family:
  • Belongs to the transglutaminase-like superfamily.
genes like me logo Genes that share domains with KY: view

Function for KY Gene

Molecular function for KY Gene

UniProtKB/Swiss-Prot Function:
Probable cytoskeleton-associated protease required for normal muscle growth. Involved in function, maturation and stabilization of the neuromuscular junction. May act by cleaving muscle-specific proteins such as FLNC (By similarity).

Enzyme Numbers (IUBMB) for KY Gene

Phenotypes From GWAS Catalog for KY Gene

Gene Ontology (GO) - Molecular Function for KY Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008233 peptidase activity IEA --
GO:0016787 hydrolase activity IEA --
genes like me logo Genes that share ontologies with KY: view
genes like me logo Genes that share phenotypes with KY: view

Human Phenotype Ontology for KY Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for KY

Clone Products

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for KY Gene

Localization for KY Gene

Subcellular locations from UniProtKB/Swiss-Prot for KY Gene

Cytoplasm, cytoskeleton. Cytoplasm, myofibril, sarcomere, Z line.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KY gene
Compartment Confidence
cytoskeleton 3
nucleus 3
mitochondrion 2
cytosol 2
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for KY Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005856 cytoskeleton IEA --
GO:0030018 Z disc ISS --
genes like me logo Genes that share ontologies with KY: view

Pathways & Interactions for KY Gene

No Data Available

Gene Ontology (GO) - Biological Process for KY Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006508 proteolysis IEA --
genes like me logo Genes that share ontologies with KY: view

No data available for Pathways by source and SIGNOR curated interactions for KY Gene

Drugs & Compounds for KY Gene

No Compound Related Data Available

Transcripts for KY Gene

mRNA/cDNA for KY Gene

Unigene Clusters for KY Gene

Kyphoscoliosis peptidase:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for KY

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for KY Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7a · 7b · 7c ^ 8 ^ 9 ^ 10 ^ 11a · 11b ^ 12
SP1: - -
SP2: - - - - - -
SP3:

Relevant External Links for KY Gene

GeneLoc Exon Structure for
KY
ECgene alternative splicing isoforms for
KY

Expression for KY Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KY Gene

mRNA differential expression in normal tissues according to GTEx for KY Gene

This gene is overexpressed in Skin - Not Sun Exposed (Suprapubic) (x4.9), Pituitary (x4.6), and Skin - Sun Exposed (Lower leg) (x4.1).

Protein differential expression in normal tissues from HIPED for KY Gene

This gene is overexpressed in Bone marrow mesenchymal stem cell (67.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for KY Gene



Protein tissue co-expression partners for KY Gene

NURSA nuclear receptor signaling pathways regulating expression of KY Gene:

KY

SOURCE GeneReport for Unigene cluster for KY Gene:

Hs.146730

mRNA Expression by UniProt/SwissProt for KY Gene:

Q8NBH2-KY_HUMAN
Tissue specificity: Highly expressed in skeletal muscle.

Evidence on tissue expression from TISSUES for KY Gene

  • Adrenal gland(4.2)
  • Nervous system(4.2)
genes like me logo Genes that share expression patterns with KY: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and Phenotype-based relationships between genes and organs from Gene ORGANizer for KY Gene

Orthologs for KY Gene

This gene was present in the common ancestor of animals.

Orthologs for KY Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia KY 34 33
  • 99.6 (n)
OneToOne
dog
(Canis familiaris)
Mammalia KY 34 33
  • 89.56 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Ky 16 34 33
  • 87.64 (n)
rat
(Rattus norvegicus)
Mammalia Ky 33
  • 86.14 (n)
oppossum
(Monodelphis domestica)
Mammalia KY 34
  • 80 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 78 (a)
OneToMany
-- 34
  • 67 (a)
OneToMany
chicken
(Gallus gallus)
Aves KY 34 33
  • 66.3 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia KY 34
  • 58 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100494696 33
  • 57.33 (n)
zebrafish
(Danio rerio)
Actinopterygii ky 34
  • 21 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta Hil 34
  • 18 (a)
OneToOne
worm
(Caenorhabditis elegans)
Secernentea ltd-1 34
  • 18 (a)
OneToOne
Species where no ortholog for KY was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for KY Gene

ENSEMBL:
Gene Tree for KY (if available)
TreeFam:
Gene Tree for KY (if available)
Aminode:
Evolutionary constrained regions (ECRs) for KY: view image

Paralogs for KY Gene

No data available for Paralogs for KY Gene

Variants for KY Gene

Sequence variations from dbSNP and Humsavar for KY Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1085307110 pathogenic, Hereditary spastic paraplegia 134,650,910(-) /ATGTCGATAGATACAGCACATGTCGATA coding_sequence_variant, frameshift
rs377332009 pathogenic, Myopathy, myofibrillar, 7 134,625,131(-) G/A/T coding_sequence_variant, stop_gained, synonymous_variant
rs886037917 pathogenic, Myopathy, myofibrillar, 7 134,608,668(-) C/ coding_sequence_variant, frameshift
rs1000055320 -- 134,642,182(-) C/T intron_variant
rs1000149804 -- 134,632,827(-) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for KY Gene

Variant ID Type Subtype PubMed ID
nsv829730 CNV loss 17160897
nsv520371 CNV loss 19592680
nsv1002382 CNV gain 25217958
esv3597857 CNV loss 21293372
esv2669745 CNV deletion 23128226

Variation tolerance for KY Gene

Residual Variation Intolerance Score: 55.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.23; 24.72% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KY Gene

Human Gene Mutation Database (HGMD)
KY
SNPedia medical, phenotypic, and genealogical associations of SNPs for
KY

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KY Gene

Disorders for KY Gene

MalaCards: The human disease database

(5) MalaCards diseases for KY Gene - From: HGMD, OMIM, ClinVar, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
myopathy, myofibrillar, 7
  • mfm7
kyphoscoliosis-lateral tongue atrophy-hereditary spastic paraplegia syndrome
  • kyphoscoliosis-lateral tongue atrophy-hsp syndrome
hereditary spastic paraplegia
  • spastic paraplegia 3, autosomal dominant
myofibrillar myopathy
  • myopathy, myofibrillar, desmin-related
myopathy
  • muscular diseases
- elite association - COSMIC cancer census association via MalaCards
Search KY in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

KY_HUMAN
  • Myopathy, myofibrillar, 7 (MFM7) [MIM:617114]: A form of myofibrillar myopathy, a group of chronic neuromuscular disorders characterized at ultrastructural level by disintegration of the sarcomeric Z disk and myofibrils, and replacement of the normal myofibrillar markings by small dense granules, or larger hyaline masses, or amorphous material. MFM7 is an autosomal recessive form, clinically characterized by early childhood onset of slowly progressive muscle weakness and mild atrophy primarily affecting the lower limbs, associated with joint contractures. {ECO:0000269 PubMed:27484770, ECO:0000269 PubMed:27485408}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for KY

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with KY: view

No data available for Genatlas for KY Gene

Publications for KY Gene

  1. Kyphoscoliosis peptidase (KY) mutation causes a novel congenital myopathy with core targetoid defects. (PMID: 27484770) Straussberg R … Schuelke M (Acta neuropathologica 2016) 3 4 58
  2. A new early-onset neuromuscular disorder associated with kyphoscoliosis peptidase (KY) deficiency. (PMID: 27485408) Hedberg-Oldfors C … Oldfors A (European journal of human genetics : EJHG 2016) 3 4 58
  3. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. Filamin C interacts with the muscular dystrophy KY protein and is abnormally distributed in mouse KY deficient muscle fibres. (PMID: 15385448) Beatham J … Blanco G (Human molecular genetics 2004) 3 4 58

Products for KY Gene

Sources for KY Gene

Content
Loading form....