Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KRTAP23-1 Gene

Aliases for KRTAP23-1 Gene

  • Keratin Associated Protein 23-1 2 3 5
  • KAP23.1 3 4
  • Keratin-Associated Protein 23-1 3

External Ids for KRTAP23-1 Gene

Previous GeneCards Identifiers for KRTAP23-1 Gene

  • GC00U906261
  • GC21U900098
  • GC21M030641
  • GC21M030642
  • GC21M031720
  • GC21M017129

Summaries for KRTAP23-1 Gene

GeneCards Summary for KRTAP23-1 Gene

KRTAP23-1 (Keratin Associated Protein 23-1) is a Protein Coding gene. Among its related pathways are Keratinization and Developmental Biology.

UniProtKB/Swiss-Prot for KRTAP23-1 Gene

  • In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Additional gene information for KRTAP23-1 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KRTAP23-1 Gene

Genomics for KRTAP23-1 Gene

GeneHancer (GH) Regulatory Elements for KRTAP23-1 Gene

Promoters and enhancers for KRTAP23-1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH21I030088 Enhancer 0.2 FANTOM5 11 +260.2 260167 0.4 ENSG00000259981 KRTAP23-1 KRTAP19-7 KRTAP27-1 KRTAP15-1 KRTAP13-3 KRTAP25-1 KRTAP19-4 KRTAP19-2 KRTAP19-6
GH21I029848 Enhancer 0.2 FANTOM5 5.5 +500.0 499967 0.3 KRTAP27-1 KRTAP23-1 KRTAP25-1 GC21P029844 GRIK1
GH21I030060 Enhancer 0.3 FANTOM5 1.6 +288.2 288156 0.2 KRTAP13-4 KRTAP19-2 KRTAP25-1 KRTAP23-1 ENSG00000259981 GRIK1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around KRTAP23-1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KRTAP23-1 gene promoter:

Genomic Locations for KRTAP23-1 Gene

Genomic Locations for KRTAP23-1 Gene
chr21:30,348,399-30,348,609
(GRCh38/hg38)
Size:
211 bases
Orientation:
Minus strand
chr21:31,720,717-31,720,924
(GRCh37/hg19)

Genomic View for KRTAP23-1 Gene

Genes around KRTAP23-1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KRTAP23-1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KRTAP23-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KRTAP23-1 Gene

Proteins for KRTAP23-1 Gene

  • Protein details for KRTAP23-1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    A1A580-KR231_HUMAN
    Recommended name:
    Keratin-associated protein 23-1
    Protein Accession:
    A1A580

    Protein attributes for KRTAP23-1 Gene

    Size:
    65 amino acids
    Molecular mass:
    6892 Da
    Quaternary structure:
    • Interacts with hair keratins.

neXtProt entry for KRTAP23-1 Gene

Post-translational modifications for KRTAP23-1 Gene

No Post-translational modifications

Other Protein References for KRTAP23-1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KRTAP23-1 Gene

Domains & Families for KRTAP23-1 Gene

Gene Families for KRTAP23-1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for KRTAP23-1 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for KRTAP23-1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with KRTAP23-1: view

No data available for UniProtKB/Swiss-Prot for KRTAP23-1 Gene

Function for KRTAP23-1 Gene

Molecular function for KRTAP23-1 Gene

UniProtKB/Swiss-Prot Function:
In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Gene Ontology (GO) - Molecular Function for KRTAP23-1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25416956
genes like me logo Genes that share ontologies with KRTAP23-1: view
genes like me logo Genes that share phenotypes with KRTAP23-1: view

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for KRTAP23-1 Gene

Localization for KRTAP23-1 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KRTAP23-1 gene
Compartment Confidence
cytosol 5
cytoskeleton 3
extracellular 2
nucleus 1

Gene Ontology (GO) - Cellular Components for KRTAP23-1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
GO:0005882 intermediate filament IEA --
genes like me logo Genes that share ontologies with KRTAP23-1: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for KRTAP23-1 Gene

Pathways & Interactions for KRTAP23-1 Gene

SuperPathways for KRTAP23-1 Gene

SuperPathway Contained pathways
1 Developmental Biology
2 Keratinization
genes like me logo Genes that share pathways with KRTAP23-1: view

Pathways by source for KRTAP23-1 Gene

2 Reactome pathways for KRTAP23-1 Gene

Interacting Proteins for KRTAP23-1 Gene

Gene Ontology (GO) - Biological Process for KRTAP23-1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0031424 keratinization TAS --
genes like me logo Genes that share ontologies with KRTAP23-1: view

No data available for SIGNOR curated interactions for KRTAP23-1 Gene

Drugs & Compounds for KRTAP23-1 Gene

No Compound Related Data Available

Transcripts for KRTAP23-1 Gene

mRNA/cDNA for KRTAP23-1 Gene

(1) REFSEQ mRNAs :
(1) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for KRTAP23-1 Gene

No ASD Table

Relevant External Links for KRTAP23-1 Gene

GeneLoc Exon Structure for
KRTAP23-1
ECgene alternative splicing isoforms for
KRTAP23-1

Expression for KRTAP23-1 Gene

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for KRTAP23-1 Gene

Orthologs for KRTAP23-1 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for KRTAP23-1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia KRTAP23-1 34
  • 94 (a)
OneToOne
Species where no ortholog for KRTAP23-1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KRTAP23-1 Gene

ENSEMBL:
Gene Tree for KRTAP23-1 (if available)
TreeFam:
Gene Tree for KRTAP23-1 (if available)

Paralogs for KRTAP23-1 Gene

No data available for Paralogs for KRTAP23-1 Gene

Variants for KRTAP23-1 Gene

Sequence variations from dbSNP and Humsavar for KRTAP23-1 Gene

SNP ID Clin Chr 21 pos Variation AA Info Type
rs1000105099 -- 30,349,996(-) T/C upstream_transcript_variant
rs1000937861 -- 30,347,902(-) G/T downstream_transcript_variant
rs1001156442 -- 30,348,869(-) TCTCTCTGTCTCTTTCTCTCT/TCTCTCT upstream_transcript_variant
rs1001497003 -- 30,350,507(-) T/C upstream_transcript_variant
rs1001827550 -- 30,348,952(-) T/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for KRTAP23-1 Gene

Variant ID Type Subtype PubMed ID
nsv834076 CNV gain 17160897
nsv587354 CNV gain 21841781
nsv1057467 CNV gain 25217958

Variation tolerance for KRTAP23-1 Gene

Residual Variation Intolerance Score: 79.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.15; 3.47% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KRTAP23-1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
KRTAP23-1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KRTAP23-1 Gene

Disorders for KRTAP23-1 Gene

Additional Disease Information for KRTAP23-1

No disorders were found for KRTAP23-1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KRTAP23-1 Gene

Publications for KRTAP23-1 Gene

  1. Characterization of a first domain of human high glycine-tyrosine and high sulfur keratin-associated protein (KAP) genes on chromosome 21q22.1. (PMID: 12359730) Rogers MA … Schweizer J (The Journal of biological chemistry 2002) 2 3 58
  2. Phospho-tyrosine dependent protein-protein interaction network. (PMID: 25814554) Grossmann A … Stelzl U (Molecular systems biology 2015) 3 58
  3. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T … Vidal M (Cell 2014) 3 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 4 58
  5. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 58

Products for KRTAP23-1 Gene

Sources for KRTAP23-1 Gene

Content
Loading form....