Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KRT6C Gene

Aliases for KRT6C Gene

  • Keratin 6C 2 3 5
  • Type-II Keratin Kb12 3 4
  • Keratin 6C, Type II 2 3
  • Cytokeratin-6C 3 4
  • Cytokeratin-6E 3 4
  • Keratin K6h 3 4
  • Keratin 6E 2 3
  • CK-6C 3 4
  • CK-6E 3 4
  • KRT6E 3 4
  • K6C 3 4
  • Keratin, Type II Cytoskeletal 6C 3
  • Keratin-6C 4
  • K6E 3

External Ids for KRT6C Gene

Previous HGNC Symbols for KRT6C Gene

  • KRT6E

Previous GeneCards Identifiers for KRT6C Gene

  • GC12U990221
  • GC12M052911
  • GC12M052597
  • GC12M051169
  • GC12M051172
  • GC12M051174
  • GC12M051150
  • GC12M052865
  • GC12M049906

Summaries for KRT6C Gene

Entrez Gene Summary for KRT6C Gene

  • Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jul 2009]

GeneCards Summary for KRT6C Gene

KRT6C (Keratin 6C) is a Protein Coding gene. Diseases associated with KRT6C include Palmoplantar Keratoderma, Nonepidermolytic, Focal Or Diffuse and Palmoplantar Keratoderma, Nonepidermolytic, Focal 1. Among its related pathways are Keratinization and Developmental Biology. Gene Ontology (GO) annotations related to this gene include structural molecule activity. An important paralog of this gene is KRT6A.

Additional gene information for KRT6C Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KRT6C Gene

Genomics for KRT6C Gene

GeneHancer (GH) Regulatory Elements for KRT6C Gene

Promoters and enhancers for KRT6C Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I052473 Promoter 0.8 EPDnew 550.8 0.0 -40 0.1 ZNF316 MAFG MAFK EMSY KRT6C PFDN5 KRT6A
GH12I052474 Enhancer 0.5 ENCODE 550.8 -0.2 -237 0.1 MAFF ZNF316 MAFG MAFK EMSY KRT6C KRT6A
GH12I052491 Promoter/Enhancer 1.9 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 21.4 -20.8 -20772 6.4 CTCF STAT1 KLF17 CEBPB SIN3A EBF1 ZIC2 SP1 JUND GLIS1 KRT6A KRT6C KRT5 KRT71 KRT82 KRT84 KRT87P KRT86 KRT2 KRT78
GH12I052439 Enhancer 1.1 Ensembl ENCODE dbSUPER 21.8 +32.1 32062 3.6 CTCF PKNOX1 ZIC2 RAD21 ZFHX2 ZNF366 POLR2A SMC3 PRDM10 FOSL2 KRT6C KRT84 KRT2 KRT4 KRT75 KRT6B GC12M052334 GC12M052373
GH12I052515 Promoter/Enhancer 1.8 EPDnew FANTOM5 ENCODE dbSUPER 11.8 -47.3 -47259 11.4 PKNOX1 ZNF133 GLIS2 SCRT2 RCOR1 FOS DEK ZNF398 MAFF GLIS1 KRT5 GC12M052518 KRT6A KRT6C KRT71 KRT74 KRT84 KRT2 KRT4 KRT82
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around KRT6C on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KRT6C gene promoter:

Genomic Locations for KRT6C Gene

Genomic Locations for KRT6C Gene
5,270 bases
Minus strand

Genomic View for KRT6C Gene

Genes around KRT6C on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KRT6C Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KRT6C Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KRT6C Gene

Proteins for KRT6C Gene

  • Protein details for KRT6C Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Keratin, type II cytoskeletal 6C
    Protein Accession:
    Secondary Accessions:
    • A1L4L5
    • P48666
    • Q2TAZ9
    • Q7RTN9

    Protein attributes for KRT6C Gene

    564 amino acids
    Molecular mass:
    60025 Da
    Quaternary structure:
    • Heterodimer of a type I and a type II keratin. KRT6 isomers associate with KRT16 and/or KRT17.
    • There are at least six isoforms of human type II keratin-6 (K6).
    • There are two types of cytoskeletal and microfibrillar keratin, I (acidic) and II (neutral to basic) (40-55 and 56-70 kDa, respectively).

neXtProt entry for KRT6C Gene

Post-translational modifications for KRT6C Gene

No Post-translational modifications

Other Protein References for KRT6C Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KRT6C Gene

Domains & Families for KRT6C Gene

Gene Families for KRT6C Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for KRT6C Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the intermediate filament family.
  • Belongs to the intermediate filament family.
genes like me logo Genes that share domains with KRT6C: view

Function for KRT6C Gene

Phenotypes From GWAS Catalog for KRT6C Gene

Gene Ontology (GO) - Molecular Function for KRT6C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005198 structural molecule activity IEA --
GO:0005515 protein binding IPI 25416956
genes like me logo Genes that share ontologies with KRT6C: view
genes like me logo Genes that share phenotypes with KRT6C: view

Human Phenotype Ontology for KRT6C Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

miRNA for KRT6C Gene

miRTarBase miRNAs that target KRT6C

Inhibitory RNA Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for KRT6C Gene

Localization for KRT6C Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KRT6C gene
Compartment Confidence
extracellular 5
cytoskeleton 5
cytosol 5
nucleus 3

Subcellular locations from the

Human Protein Atlas (HPA)
  • Intermediate filaments (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for KRT6C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
GO:0005882 intermediate filament NAS 9054461
GO:0045095 keratin filament IEA --
GO:0070062 extracellular exosome IDA,HDA 23533145
genes like me logo Genes that share ontologies with KRT6C: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for KRT6C Gene

Pathways & Interactions for KRT6C Gene

genes like me logo Genes that share pathways with KRT6C: view

Pathways by source for KRT6C Gene

1 Cell Signaling Technology pathway for KRT6C Gene
2 Reactome pathways for KRT6C Gene
1 GeneGo (Thomson Reuters) pathway for KRT6C Gene

Gene Ontology (GO) - Biological Process for KRT6C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0031424 keratinization TAS --
GO:0045104 intermediate filament cytoskeleton organization IMP 23662636
GO:0070268 cornification TAS --
genes like me logo Genes that share ontologies with KRT6C: view

No data available for SIGNOR curated interactions for KRT6C Gene

Drugs & Compounds for KRT6C Gene

No Compound Related Data Available

Transcripts for KRT6C Gene

mRNA/cDNA for KRT6C Gene

(1) REFSEQ mRNAs :
(6) Additional mRNA sequences :
(4) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for KRT6C Gene

Keratin 6C:
Representative Sequences:

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for KRT6C Gene

No ASD Table

Relevant External Links for KRT6C Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KRT6C Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KRT6C Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for KRT6C Gene

This gene is overexpressed in Esophagus - Mucosa (x28.7), Vagina (x9.7), Cervix - Ectocervix (x7.7), and Minor Salivary Gland (x4.4).

Protein differential expression in normal tissues from HIPED for KRT6C Gene

This gene is overexpressed in Saliva (41.8) and Urinary Bladder (9.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for KRT6C Gene

Protein tissue co-expression partners for KRT6C Gene

NURSA nuclear receptor signaling pathways regulating expression of KRT6C Gene:


SOURCE GeneReport for Unigene cluster for KRT6C Gene:


mRNA Expression by UniProt/SwissProt for KRT6C Gene:

Tissue specificity: Constitutively expressed in distinct types of epithelia such as those in oral mucosa, esophagus, papillae of tongue and hair follicle outer root sheath.

Evidence on tissue expression from TISSUES for KRT6C Gene

  • Skin(4.8)
  • Nervous system(4.6)

Phenotype-based relationships between genes and organs from Gene ORGANizer for KRT6C Gene

Germ Layers:
  • ectoderm
  • integumentary
  • foot
  • hand
  • lower limb
  • upper limb
  • skin
genes like me logo Genes that share expression patterns with KRT6C: view

Primer Products

Orthologs for KRT6C Gene

This gene was present in the common ancestor of chordates.

Orthologs for KRT6C Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia -- 34
  • 99 (a)
KRT6B 33
  • 98.58 (n)
(Canis familiaris)
Mammalia -- 34
  • 88 (a)
(Bos Taurus)
Mammalia -- 34
  • 87 (a)
-- 34
  • 86 (a)
KRT6B 34
  • 86 (a)
(Mus musculus)
Mammalia Krt6a 34
  • 87 (a)
Krt6b 34
  • 86 (a)
Gm5414 34
  • 69 (a)
(Monodelphis domestica)
Mammalia -- 34
  • 73 (a)
(Gallus gallus)
Aves KRT6A 34
  • 72 (a)
KRT75 34
  • 66 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 67 (a)
Species where no ortholog for KRT6C was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for KRT6C Gene

Gene Tree for KRT6C (if available)
Gene Tree for KRT6C (if available)

Paralogs for KRT6C Gene

Paralogs for KRT6C Gene

genes like me logo Genes that share paralogs with KRT6C: view

Variants for KRT6C Gene

Sequence variations from dbSNP and Humsavar for KRT6C Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs267607474 not-provided, pathogenic, not provided, Palmoplantar keratoderma, nonepidermolytic, focal 52,473,220(-) TTGTTGTTG/TTGTTG coding_sequence_variant, inframe_deletion
rs267607475 not-provided, pathogenic, not provided, Palmoplantar keratoderma, nonepidermolytic, focal 52,469,684(-) CTCCAGCAGCTTGCGGTAGGTGGCGATCTCCA/CTCCA coding_sequence_variant, inframe_deletion
rs587777292 pathogenic, Palmoplantar keratoderma, nonepidermolytic, focal or diffuse, not provided, Palmoplantar keratoderma, non-epidermolytic, focal or diffuse (PPKNEFD) [MIM:615735] 52,469,680(-) C/T coding_sequence_variant, missense_variant
rs1000113268 -- 52,470,936(-) T/G intron_variant
rs1001579291 -- 52,470,292(-) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for KRT6C Gene

Variant ID Type Subtype PubMed ID
nsv975491 CNV duplication 23825009
nsv832412 CNV loss 17160897
nsv832411 CNV loss 17160897
nsv832410 CNV gain 17160897
nsv1039931 CNV gain 25217958
nsv1035936 CNV gain 25217958
esv7827 CNV loss 19470904
esv3629518 CNV loss 21293372
esv3581627 CNV gain 25503493
esv2751106 CNV loss 17911159
esv2745892 CNV deletion 23290073
esv2660079 CNV deletion 23128226
dgv95n21 CNV loss 19592680
dgv2633n54 CNV loss 21841781
dgv1505n100 CNV loss 25217958

Variation tolerance for KRT6C Gene

Residual Variation Intolerance Score: 95.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 20.15; 99.03% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KRT6C Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KRT6C Gene

Disorders for KRT6C Gene

MalaCards: The human disease database

(2) MalaCards diseases for KRT6C Gene - From: OMIM, ClinVar, GTR, Orphanet, and Swiss-Prot

- elite association - COSMIC cancer census association via MalaCards
Search KRT6C in MalaCards View complete list of genes associated with diseases


  • Palmoplantar keratoderma, non-epidermolytic, focal or diffuse (PPKNEFD) [MIM:615735]: A dermatological disorder characterized by non-epidermolytic abnormal thickening of the skin on the palms and soles. Diffuse palmoplantar keratoderma is characterized by uniform involvement of the palmoplantar surface, while the focal form consists of localized areas of hyperkeratosis located mainly on pressure points and sites of recurrent friction. {ECO:0000269 PubMed:19609311, ECO:0000269 PubMed:21801157, ECO:0000269 PubMed:23662636}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for KRT6C

genes like me logo Genes that share disorders with KRT6C: view

No data available for Genatlas for KRT6C Gene

Publications for KRT6C Gene

  1. Cloning and characterization of multiple human genes and cDNAs encoding highly related type II keratin 6 isoforms. (PMID: 7543104) Takahashi K … Coulombe PA (The Journal of biological chemistry 1995) 2 3 4 58
  2. Collapse of the keratin filament network through the expression of mutant keratin 6c observed in a case of focal plantar keratoderma. (PMID: 23662636) Kubo A … Amagai M (The Journal of dermatology 2013) 3 4 58
  3. Keratin K6c mutations cause focal palmoplantar keratoderma. (PMID: 19609311) Wilson NJ … Smith FJ (The Journal of investigative dermatology 2010) 3 4 58
  4. New consensus nomenclature for mammalian keratins. (PMID: 16831889) Schweizer J … Wright MW (The Journal of cell biology 2006) 2 3 58
  5. The finished DNA sequence of human chromosome 12. (PMID: 16541075) Scherer SE … Baylor College of Medicine Human Genome Sequencing Center Sequence Production Team (Nature 2006) 3 4 58

Products for KRT6C Gene

Sources for KRT6C Gene

Loading form....