The protein encoded by this gene is a light chain of kinesin, a molecular motor responsible for moving vesicles and organelles along microtubules. Defects in this gene are a cause of spastic paraplegia, optic atrophy, and neuropathy (SPOAN) syndrome. [provided by RefSeq, Mar 2016] See more...

Aliases for KLC2 Gene

Aliases for KLC2 Gene

  • Kinesin Light Chain 2 2 3 4 5
  • KLC 2 3 4

External Ids for KLC2 Gene

Previous GeneCards Identifiers for KLC2 Gene

  • GC19U990148
  • GC11P067706
  • GC11P066275
  • GC11P065800
  • GC11P065781
  • GC11P066026
  • GC11P062350

Summaries for KLC2 Gene

Entrez Gene Summary for KLC2 Gene

  • The protein encoded by this gene is a light chain of kinesin, a molecular motor responsible for moving vesicles and organelles along microtubules. Defects in this gene are a cause of spastic paraplegia, optic atrophy, and neuropathy (SPOAN) syndrome. [provided by RefSeq, Mar 2016]

GeneCards Summary for KLC2 Gene

KLC2 (Kinesin Light Chain 2) is a Protein Coding gene. Diseases associated with KLC2 include Spastic Paraplegia, Optic Atrophy, And Neuropathy. Among its related pathways are Vesicle-mediated transport and Golgi-to-ER retrograde transport. Gene Ontology (GO) annotations related to this gene include microtubule motor activity and kinesin binding. An important paralog of this gene is KLC4.

UniProtKB/Swiss-Prot Summary for KLC2 Gene

  • Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. The light chain may function in coupling of cargo to the heavy chain or in the modulation of its ATPase activity (By similarity).

Gene Wiki entry for KLC2 Gene

Additional gene information for KLC2 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for KLC2 Gene

Genomics for KLC2 Gene

GeneHancer (GH) Regulatory Elements for KLC2 Gene

Promoters and enhancers for KLC2 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11J066256 Promoter/Enhancer 2 EPDnew Ensembl ENCODE CraniofacialAtlas 757.1 +0.7 665 3.3 SIN3A ZBTB40 CTCF RBPJ SMARCE1 POLR2A NR2F6 HCFC1 MYC MAX KLC2 KDM2A RAB1B POLA2 PCNX3 EIF1AD BRMS1 RELA ENSG00000255320 NEAT1
GH11J066255 Enhancer 0.2 Ensembl 750.6 -2.0 -1993 0.2 KLC2 ENSG00000255320
GH11J066342 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 11.9 +91.3 91251 11.8 GTF3C2 SIN3A ZNF24 SP1 ZBTB40 CTCF SIX5 FOXA1 MLX RBPJ B4GAT1 ENSG00000255468 LOC102724064 TRS-GCT3-1 piR-34439-001 RBM14 EIF1AD ENSG00000254855 KAT5 RBM4
GH11J065470 Promoter/Enhancer 2.8 VISTA FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 11.7 -767.1 -767149 40.1 PPP1R10 E2F8 SIN3A ZNF24 SP1 ZBTB40 CTCF SREBF1 ZBTB6 FOXA1 ENSG00000279243 LINC02736 SF1 POLA2 ZFPL1 ENSG00000254855 PCNX3 KAT5 EIF1AD SF3B2
GH11J065884 Promoter/Enhancer 2.9 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 11.2 -362.9 -362854 20.5 SIN3A ZNF24 ZBTB40 SP1 CTCF SIX5 FOXA1 ZBTB6 MLX RBPJ FOSL1 FIBP DRAP1 RBM14 EIF1AD RBM4 POLA2 SART1 SNX32 MUS81
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around KLC2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KLC2 gene promoter:
  • c-Ets-1
  • E2F
  • E2F-1
  • E2F-2

Genomic Locations for KLC2 Gene

Genomic Locations for KLC2 Gene
chr11:66,257,294-66,267,861
(GRCh38/hg38)
Size:
10,568 bases
Orientation:
Plus strand
chr11:66,024,765-66,035,332
(GRCh37/hg19)
Size:
10,568 bases
Orientation:
Plus strand

Genomic View for KLC2 Gene

Genes around KLC2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KLC2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KLC2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KLC2 Gene

Proteins for KLC2 Gene

  • Protein details for KLC2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9H0B6-KLC2_HUMAN
    Recommended name:
    Kinesin light chain 2
    Protein Accession:
    Q9H0B6
    Secondary Accessions:
    • A8MXL7
    • B2RDY4
    • Q9H9C8
    • Q9HA20

    Protein attributes for KLC2 Gene

    Size:
    622 amino acids
    Molecular mass:
    68935 Da
    Quaternary structure:
    • Oligomeric complex composed of two heavy chains and two light chains.

    Three dimensional structures from OCA and Proteopedia for KLC2 Gene

    Alternative splice isoforms for KLC2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for KLC2 Gene

Post-translational modifications for KLC2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for KLC2 Gene

Domains & Families for KLC2 Gene

Gene Families for KLC2 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for KLC2 Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ37274 fis, clone BRAMY2012162, highly similar to Kinesin light chain 2 (A8MXL7_HUMAN)
  • Kinesin light chain 2 (KLC2_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q9H0B6

UniProtKB/Swiss-Prot:

KLC2_HUMAN :
  • Belongs to the kinesin light chain family.
Family:
  • Belongs to the kinesin light chain family.
genes like me logo Genes that share domains with KLC2: view

Function for KLC2 Gene

Molecular function for KLC2 Gene

UniProtKB/Swiss-Prot Function:
Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. The light chain may function in coupling of cargo to the heavy chain or in the modulation of its ATPase activity (By similarity).
GENATLAS Biochemistry:
kinesin,light chain,beta 2,with homology to purple sea urchin SPKLC,widely expressed

Phenotypes From GWAS Catalog for KLC2 Gene

Gene Ontology (GO) - Molecular Function for KLC2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003777 microtubule motor activity IEA --
GO:0005515 protein binding IPI 14985359
GO:0019894 kinesin binding ISS --
GO:0045296 cadherin binding HDA 25468996
genes like me logo Genes that share ontologies with KLC2: view
genes like me logo Genes that share phenotypes with KLC2: view

Human Phenotype Ontology for KLC2 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for KLC2 Gene

MGI Knock Outs for KLC2:
  • Klc2 Klc2<tm1e(EUCOMM)Wtsi>

Animal Model Products

CRISPR Products

Clone Products

  • Addgene plasmids for KLC2

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for KLC2 Gene

Localization for KLC2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for KLC2 Gene

Cytoplasm, cytoskeleton.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KLC2 gene
Compartment Confidence
cytosol 5
plasma membrane 4
cytoskeleton 4
mitochondrion 4
nucleus 4
golgi apparatus 1
extracellular 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Nucleoplasm (3)
  • Plasma membrane (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for KLC2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm IDA --
GO:0005737 cytoplasm IEA --
GO:0005739 mitochondrion IDA --
GO:0005829 cytosol ISS,TAS --
GO:0005856 cytoskeleton IEA --
genes like me logo Genes that share ontologies with KLC2: view

Pathways & Interactions for KLC2 Gene

genes like me logo Genes that share pathways with KLC2: view

SIGNOR curated interactions for KLC2 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for KLC2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006890 retrograde vesicle-mediated transport, Golgi to ER TAS --
GO:0007018 microtubule-based movement TAS --
GO:0019886 antigen processing and presentation of exogenous peptide antigen via MHC class II TAS --
genes like me logo Genes that share ontologies with KLC2: view

Drugs & Compounds for KLC2 Gene

No Compound Related Data Available

Transcripts for KLC2 Gene

CRISPR Products

Clone Products

  • Addgene plasmids for KLC2

Alternative Splicing Database (ASD) splice patterns (SP) for KLC2 Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b · 4c ^ 5a · 5b · 5c · 5d ^ 6a · 6b ^ 7a · 7b ^ 8a · 8b · 8c ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^
SP1:
SP2: - - -
SP3: - - - -
SP4: - - - - - -
SP5: - - - - -
SP6: - -
SP7:
SP8: - - - - - -
SP9: - - - -
SP10: -

ExUns: 16a · 16b ^ 17 ^ 18
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:

Relevant External Links for KLC2 Gene

GeneLoc Exon Structure for
KLC2
ECgene alternative splicing isoforms for
KLC2

Expression for KLC2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KLC2 Gene

Protein differential expression in normal tissues from HIPED for KLC2 Gene

This gene is overexpressed in Adipocyte (23.5) and Fetal Brain (9.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for KLC2 Gene



Protein tissue co-expression partners for KLC2 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of KLC2 Gene:

KLC2

SOURCE GeneReport for Unigene cluster for KLC2 Gene:

Hs.280792

Evidence on tissue expression from TISSUES for KLC2 Gene

  • Liver(4.2)
  • Nervous system(3.7)
genes like me logo Genes that share expression patterns with KLC2: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for KLC2 Gene

Orthologs for KLC2 Gene

This gene was present in the common ancestor of animals.

Orthologs for KLC2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia KLC2 33 32
  • 99.41 (n)
OneToOne
cow
(Bos Taurus)
Mammalia KLC2 33 32
  • 90.41 (n)
OneToOne
dog
(Canis familiaris)
Mammalia KLC2 33 32
  • 89.07 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Klc2 17 33 32
  • 88.05 (n)
oppossum
(Monodelphis domestica)
Mammalia KLC2 33
  • 88 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Klc2 32
  • 87.83 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 33
  • 76 (a)
ManyToMany
lizard
(Anolis carolinensis)
Reptilia KLC2 33
  • 79 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii klc2 33 32
  • 73.61 (n)
OneToOne
zgc55666 32
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.13210 32
fruit fly
(Drosophila melanogaster)
Insecta Klc 33
  • 67 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea klc-2 33
  • 58 (a)
ManyToMany
klc-1 33
  • 41 (a)
ManyToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 62 (a)
OneToMany
Species where no ortholog for KLC2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for KLC2 Gene

ENSEMBL:
Gene Tree for KLC2 (if available)
TreeFam:
Gene Tree for KLC2 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for KLC2: view image

Paralogs for KLC2 Gene

Paralogs for KLC2 Gene

(5) SIMAP similar genes for KLC2 Gene using alignment to 9 proteins:

  • KLC2_HUMAN
  • A8MX29_HUMAN
  • A8MZ87_HUMAN
  • C9JHT2_HUMAN
  • E9PI24_HUMAN
  • E9PM83_HUMAN
  • E9PP09_HUMAN
  • E9PQ02_HUMAN
  • L8EAC5_HUMAN
genes like me logo Genes that share paralogs with KLC2: view

Variants for KLC2 Gene

Sequence variations from dbSNP and Humsavar for KLC2 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs1554996989 pathogenic, Spastic paraplegia, optic atrophy, and neuropathy 66,257,086(+) GCTAGGGCTGTGGATGAGCACTGCAGGAAGGCACTTCGGGGTCTATCAGAGGAAATTTTTGCTAACCTTCCGAGTTGTCTCAGAGCCAAACGTAGTAAGCTACCTGTCACCGGATGTGCTTGAGCTAAGGGCGCTGAACCACCTCTGTCAGAGACGGTGCATCCCCCACCGGATGTGACCCCGGGATGCGGAGCCTGGGGTCAGATCTGCGAGCCAG/ 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant
rs1565174024 uncertain-significance, not provided 66,264,403(+) T/C coding_sequence_variant, missense_variant
rs1565176310 uncertain-significance, not provided 66,266,151(+) G/A coding_sequence_variant, missense_variant
rs1000423122 -- 66,267,715(+) T/C 3_prime_UTR_variant
rs1000752780 -- 66,266,578(+) T/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for KLC2 Gene

Variant ID Type Subtype PubMed ID
esv1000442 OTHER inversion 20482838

Variation tolerance for KLC2 Gene

Residual Variation Intolerance Score: 11% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.00; 80.03% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KLC2 Gene

Human Gene Mutation Database (HGMD)
KLC2
SNPedia medical, phenotypic, and genealogical associations of SNPs for
KLC2

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KLC2 Gene

Disorders for KLC2 Gene

MalaCards: The human disease database

(1) MalaCards diseases for KLC2 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search KLC2 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

KLC2_HUMAN
  • Spastic paraplegia, optic atrophy, and neuropathy (SPOAN) [MIM:609541]: A form of spastic paraplegia, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. SPOAN is characterized by spastic paraplegia with progressive joint contractures and spine deformities, loss of independent ambulation by age 10 years, sub-normal vision secondary to congenital optic atrophy, and neuropathy. Inheritance is autosomal recessive. {ECO:0000269 PubMed:26385635}. Note=The gene represented in this entry is involved in disease pathogenesis. The disease is caused by a homozygous deletion in the non-coding region of the KLC2 gene. {ECO:0000269 PubMed:26385635}.

Additional Disease Information for KLC2

genes like me logo Genes that share disorders with KLC2: view

No data available for Genatlas for KLC2 Gene

Publications for KLC2 Gene

  1. Overexpression of KLC2 due to a homozygous deletion in the non-coding region causes SPOAN syndrome. (PMID: 26385635) Melo US … Santos S (Human molecular genetics 2015) 3 4 56
  2. Role of kinesin light chain-2 of kinesin-1 in the traffic of Na,K-ATPase-containing vesicles in alveolar epithelial cells. (PMID: 19773350) Trejo HE … Sznajder JI (FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2010) 3 23 56
  3. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. (PMID: 17081983) Olsen JV … Mann M (Cell 2006) 3 4 56
  4. A probability-based approach for high-throughput protein phosphorylation analysis and site localization. (PMID: 16964243) Beausoleil SA … Gygi SP (Nature biotechnology 2006) 3 4 56
  5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56

Products for KLC2 Gene