KIF26B Gene (Protein Coding)

Kinesin Family Member 26B

GC01P245154
GIFtS:
37
The protein encoded by this gene is an intracellular motor protein thought to transport organelles along microtubules. The encoded protein is required for kidney development. Elevated levels of this protein have been found in some breast and colorectal cancers. [provided by RefSeq, Mar 2017] See more...

Aliases for KIF26B Gene

Aliases for KIF26B Gene

  • Kinesin Family Member 26B 2 3 5
  • Kinesin-Like Protein KIF26B 3 4

External Ids for KIF26B Gene

Previous GeneCards Identifiers for KIF26B Gene

  • GC01P243384
  • GC01P245318
  • GC01P215701

Summaries for KIF26B Gene

Entrez Gene Summary for KIF26B Gene

  • The protein encoded by this gene is an intracellular motor protein thought to transport organelles along microtubules. The encoded protein is required for kidney development. Elevated levels of this protein have been found in some breast and colorectal cancers. [provided by RefSeq, Mar 2017]

GeneCards Summary for KIF26B Gene

KIF26B (Kinesin Family Member 26B) is a Protein Coding gene. Diseases associated with KIF26B include Papillorenal Syndrome. Among its related pathways are Vesicle-mediated transport and Golgi-to-ER retrograde transport. Gene Ontology (GO) annotations related to this gene include ATPase activity and microtubule motor activity. An important paralog of this gene is KIF26A.

UniProtKB/Swiss-Prot Summary for KIF26B Gene

  • Essential for embryonic kidney development. Plays an important role in the compact adhesion between mesenchymal cells adjacent to the ureteric buds, possibly by interacting with MYH10. This could lead to the establishment of the basolateral integrity of the mesenchyme and the polarized expression of ITGA8, which maintains the GDNF expression required for further ureteric bud attraction. Although it seems to lack ATPase activity it is constitutively associated with microtubules (By similarity).

Additional gene information for KIF26B Gene

No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for KIF26B Gene

Genomics for KIF26B Gene

GeneHancer (GH) Regulatory Elements for KIF26B Gene

Promoters and enhancers for KIF26B Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around KIF26B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KIF26B gene promoter:
  • FOXI1
  • HFH-3
  • Hlf
  • Lhx3a
  • LHX3b
  • MZF-1
  • Olf-1
  • RREB-1
  • S8
  • SRY

Genomic Locations for KIF26B Gene

Genomic Locations for KIF26B Gene
chr1:245,154,985-245,709,432
(GRCh38/hg38)
Size:
554,448 bases
Orientation:
Plus strand
chr1:245,318,287-245,872,733
(GRCh37/hg19)
Size:
554,447 bases
Orientation:
Plus strand

Genomic View for KIF26B Gene

Genes around KIF26B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KIF26B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KIF26B Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for KIF26B Gene

Proteins for KIF26B Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for KIF26B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q2KJY2-KI26B_HUMAN
    Recommended name:
    Kinesin-like protein KIF26B
    Protein Accession:
    Q2KJY2
    Secondary Accessions:
    • Q6ZQR9
    • Q6ZUZ0
    • Q8IUN3
    • Q8IVR1
    • Q9NWB4

    Protein attributes for KIF26B Gene

    Size:
    2108 amino acids
    Molecular mass:
    223883 Da
    Quaternary structure:
    • Interacts with MYH10.
    SequenceCaution:
    • Sequence=AAH42481.1; Type=Miscellaneous discrepancy; Note=Probable cloning artifact.; Evidence={ECO:0000305}; Sequence=BAA91469.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAC86076.1; Type=Miscellaneous discrepancy; Note=Aberrant splicing.; Evidence={ECO:0000305}; Sequence=BAC87614.1; Type=Miscellaneous discrepancy; Note=Intron retention.; Evidence={ECO:0000305};

    Alternative splice isoforms for KIF26B Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for KIF26B Gene

Protein Expression for KIF26B Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for KIF26B Gene

  • Phosphorylation at Thr-1855 and Ser-1958 by CDKs, mainly CDK2 and CDK5, enhances the interaction with NEDD4, polyubiquitination, and subsequent proteasomal degradation. Phosphorylation occurs upon loss of interaction with microtubules (By similarity).
  • Polyubiquitinated by NEDD4, resulting in proteasomal degradation.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for KIF26B Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KIF26B Gene

Domains & Families for KIF26B Gene

Gene Families for KIF26B Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for KIF26B Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for KIF26B Gene

GenScript: Design optimal peptide antigens:
  • Kinesin-like protein KIF26B (KI26B_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q2KJY2

UniProtKB/Swiss-Prot:

KI26B_HUMAN :
  • Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIF26 subfamily.
Family:
  • Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIF26 subfamily.
genes like me logo Genes that share domains with KIF26B: view

Function for KIF26B Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for KIF26B Gene

UniProtKB/Swiss-Prot Function:
Essential for embryonic kidney development. Plays an important role in the compact adhesion between mesenchymal cells adjacent to the ureteric buds, possibly by interacting with MYH10. This could lead to the establishment of the basolateral integrity of the mesenchyme and the polarized expression of ITGA8, which maintains the GDNF expression required for further ureteric bud attraction. Although it seems to lack ATPase activity it is constitutively associated with microtubules (By similarity).

Phenotypes From GWAS Catalog for KIF26B Gene

Gene Ontology (GO) - Molecular Function for KIF26B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003774 motor activity IEA --
GO:0003777 microtubule motor activity IEA,IBA 21873635
GO:0005524 ATP binding IEA --
GO:0008017 microtubule binding IBA,IEA 21873635
GO:0016887 NOT ATPase activity IBA 21873635
genes like me logo Genes that share ontologies with KIF26B: view
genes like me logo Genes that share phenotypes with KIF26B: view

Animal Models for KIF26B Gene

MGI Knock Outs for KIF26B:

Animal Model Products

CRISPR Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KIF26B Gene

Localization for KIF26B Gene

Subcellular locations from UniProtKB/Swiss-Prot for KIF26B Gene

Cytoplasm. Cytoplasm, cytoskeleton.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KIF26B gene
Compartment Confidence
cytoskeleton 4
plasma membrane 2
nucleus 1
cytosol 1
mitochondrion 0
peroxisome 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Microtubules (2)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for KIF26B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005856 cytoskeleton IEA --
GO:0005871 kinesin complex IBA 21873635
GO:0005874 microtubule IBA 21873635
genes like me logo Genes that share ontologies with KIF26B: view

Pathways & Interactions for KIF26B Gene

genes like me logo Genes that share pathways with KIF26B: view

Gene Ontology (GO) - Biological Process for KIF26B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007018 NOT microtubule-based movement IBA,IEA 21873635
GO:0007275 multicellular organism development IEA --
GO:0022409 positive regulation of cell-cell adhesion IEA --
GO:0030010 establishment of cell polarity IEA --
GO:0072092 ureteric bud invasion IEA --
genes like me logo Genes that share ontologies with KIF26B: view

No data available for SIGNOR curated interactions for KIF26B Gene

Drugs & Compounds for KIF26B Gene

Products:

  1. Drug
No Compound Related Data Available

Transcripts for KIF26B Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for KIF26B Gene

(1) REFSEQ mRNAs :
(9) Additional mRNA sequences :
(3) Selected AceView cDNA sequences:
(4) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for KIF26B Gene

No ASD Table

Relevant External Links for KIF26B Gene

GeneLoc Exon Structure for
KIF26B
ECgene alternative splicing isoforms for
KIF26B

Expression for KIF26B Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KIF26B Gene

mRNA expression in normal human tissues for KIF26B Gene
mRNA expression by BioGPS for KIF26B GenemRNA expression by GTEx for KIF26B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for KIF26B Gene

This gene is overexpressed in Brain - Cerebellar Hemisphere (x4.1).

Protein differential expression in normal tissues from HIPED for KIF26B Gene

This gene is overexpressed in Liver (38.0), Adipocyte (11.7), Monocytes (7.4), and Retina (7.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for KIF26B Gene



Protein tissue co-expression partners for KIF26B Gene

NURSA nuclear receptor signaling pathways regulating expression of KIF26B Gene:

KIF26B

SOURCE GeneReport for Unigene cluster for KIF26B Gene:

Hs.368096

Evidence on tissue expression from TISSUES for KIF26B Gene

  • Blood(4.1)
  • Nervous system(4.1)
genes like me logo Genes that share expression patterns with KIF26B: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for KIF26B Gene

Orthologs for KIF26B Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for KIF26B Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia KIF26B 33 32
  • 98.72 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia KIF26B 33 32
  • 88 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia KIF26B 33 32
  • 86.87 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Kif26b 32
  • 84.9 (n)
mouse
(Mus musculus)
 Mammalia Kif26b 17 33 32
  • 84.89 (n)
oppossum
(Monodelphis domestica)
 Mammalia KIF26B 33
  • 83 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia KIF26B 33
  • 73 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves KIF26B 33 32
  • 75.29 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia KIF26B 33
  • 75 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia kif26b 32
  • 67.56 (n)
zebrafish
(Danio rerio)
 Actinopterygii kif26ba 33 32
  • 63.72 (n)
 OneToOne
fruit fly
(Drosophila melanogaster)
 Insecta CG14535 33
  • 26 (a)
 OneToMany
worm
(Caenorhabditis elegans)
 Secernentea vab-8 33
  • 23 (a)
 OneToMany
baker's yeast
(Saccharomyces cerevisiae)
 Saccharomycetes SMY1 33
  • 23 (a)
 OneToMany
Species where no ortholog for KIF26B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for KIF26B Gene

ENSEMBL:
Gene Tree for KIF26B (if available)
TreeFam:
Gene Tree for KIF26B (if available)
Aminode:
Evolutionary constrained regions (ECRs) for KIF26B: view image

Paralogs for KIF26B Gene

Paralogs for KIF26B Gene

(1) SIMAP similar genes for KIF26B Gene using alignment to 2 proteins:

  • KI26B_HUMAN
  • B7WPD9_HUMAN
genes like me logo Genes that share paralogs with KIF26B: view

Variants for KIF26B Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for KIF26B Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs749953234 uncertain-significance, not provided, - 245,688,693(+) G/A/C/T coding_sequence_variant, missense_variant
rs886037758 pathogenic, not provided 245,688,126(+) GGGACCTCGCCCCCCAGCTCCGGGG/GGG coding_sequence_variant, frameshift
rs3806273 benign, not specified 245,687,204(+) G/A/C/T coding_sequence_variant, synonymous_variant
rs3820246 benign, not specified 245,686,427(+) G/A coding_sequence_variant, synonymous_variant
rs58427858 benign, not specified 245,687,987(+) G/A/T coding_sequence_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for KIF26B Gene

Variant ID Type Subtype PubMed ID
dgv113n67 CNV loss 20364138
dgv161e212 CNV loss 25503493
dgv162e212 CNV loss 25503493
dgv315n106 CNV deletion 24896259
dgv326e59 CNV duplication 20981092
dgv59e201 CNV deletion 23290073
dgv602n100 CNV gain 25217958
dgv62n27 CNV loss 19166990
dgv882n54 CNV loss 21841781
dgv883n54 CNV loss 21841781
dgv884n54 CNV loss 21841781
dgv885n54 CNV loss 21841781
esv1010286 CNV insertion 20482838
esv1330272 CNV deletion 17803354
esv1366991 CNV deletion 17803354
esv1457319 CNV deletion 17803354
esv1635429 CNV deletion 17803354
esv1719464 CNV deletion 17803354
esv1751553 CNV insertion 17803354
esv1756438 CNV deletion 17803354
esv1770455 CNV deletion 17803354
esv1786816 CNV insertion 17803354
esv1964314 CNV deletion 18987734
esv2112759 CNV deletion 18987734
esv22570 CNV loss 19812545
esv2275975 CNV deletion 18987734
esv2374353 CNV deletion 18987734
esv2421654 CNV deletion 20811451
esv2606381 CNV deletion 19546169
esv2636493 CNV insertion 19546169
esv2659202 CNV deletion 23128226
esv2662066 CNV deletion 23128226
esv2673051 CNV deletion 23128226
esv2676437 CNV deletion 23128226
esv2677310 CNV deletion 23128226
esv2726773 CNV deletion 23290073
esv2726784 CNV deletion 23290073
esv2726795 CNV deletion 23290073
esv2726807 CNV deletion 23290073
esv2726818 CNV deletion 23290073
esv2726829 CNV deletion 23290073
esv2726840 CNV deletion 23290073
esv2726851 CNV deletion 23290073
esv2726862 CNV deletion 23290073
esv2726873 CNV deletion 23290073
esv2726884 CNV deletion 23290073
esv2726906 CNV deletion 23290073
esv2726929 CNV deletion 23290073
esv2726940 CNV deletion 23290073
esv2726951 CNV deletion 23290073
esv2726962 CNV deletion 23290073
esv2726973 CNV deletion 23290073
esv2726984 CNV deletion 23290073
esv2726995 CNV deletion 23290073
esv2727006 CNV deletion 23290073
esv2727017 CNV deletion 23290073
esv2727029 CNV deletion 23290073
esv2727040 CNV deletion 23290073
esv2727051 CNV deletion 23290073
esv2763758 CNV loss 21179565
esv28270 CNV gain 19812545
esv29096 CNV loss 19812545
esv3337403 CNV insertion 20981092
esv33776 CNV loss 17666407
esv3430624 CNV duplication 20981092
esv3549888 CNV deletion 23714750
esv3549900 CNV deletion 23714750
esv3549922 CNV deletion 23714750
esv3549955 CNV deletion 23714750
esv3575839 CNV gain 25503493
esv3589431 CNV loss 21293372
esv3589432 CNV loss 21293372
esv3589433 CNV loss 21293372
esv3589434 CNV loss 21293372
esv3589435 CNV loss 21293372
esv3589436 CNV loss 21293372
esv3589437 CNV loss 21293372
esv3589438 CNV loss 21293372
esv3589439 CNV loss 21293372
esv3589440 CNV loss 21293372
esv3589441 CNV loss 21293372
esv3589442 CNV loss 21293372
esv3589443 CNV loss 21293372
esv3589444 CNV loss 21293372
esv3589446 CNV loss 21293372
esv3891304 CNV loss 25118596
esv3891315 CNV loss 25118596
esv4377 CNV loss 18987735
esv4958 CNV loss 18987735
esv994414 CNV deletion 20482838
esv999717 CNV deletion 20482838
nsv1001831 CNV loss 25217958
nsv1002555 CNV loss 25217958
nsv1010191 CNV loss 25217958
nsv1011796 CNV gain 25217958
nsv1015005 CNV loss 25217958
nsv1068644 CNV deletion 25765185
nsv1069428 CNV deletion 25765185
nsv1120205 CNV tandem duplication 24896259
nsv1120629 CNV deletion 24896259
nsv1121084 CNV deletion 24896259
nsv1145417 CNV deletion 24896259
nsv1147088 CNV deletion 26484159
nsv1148568 CNV deletion 26484159
nsv1160480 CNV deletion 26073780
nsv1160481 CNV deletion 26073780
nsv161160 CNV deletion 16902084
nsv441744 CNV loss 18776908
nsv441745 CNV loss 18776908
nsv468761 CNV loss 19166990
nsv468783 CNV loss 19166990
nsv470791 CNV loss 18288195
nsv472200 CNV novel sequence insertion 20440878
nsv472353 CNV novel sequence insertion 20440878
nsv474177 CNV novel sequence insertion 20440878
nsv475886 CNV novel sequence insertion 20440878
nsv477195 CNV novel sequence insertion 20440878
nsv479117 CNV novel sequence insertion 20440878
nsv479136 CNV novel sequence insertion 20440878
nsv480246 CNV novel sequence insertion 20440878
nsv480417 CNV novel sequence insertion 20440878
nsv480549 CNV novel sequence insertion 20440878
nsv508704 CNV deletion 20534489
nsv509735 CNV insertion 20534489
nsv515634 CNV loss 19592680
nsv517138 CNV loss 19592680
nsv517322 CNV loss 19592680
nsv517510 CNV loss 19592680
nsv5199 CNV insertion 18451855
nsv5210 CNV insertion 18451855
nsv521141 CNV loss 19592680
nsv5221 CNV insertion 18451855
nsv522286 CNV gain 19592680
nsv5232 CNV insertion 18451855
nsv524642 CNV loss 19592680
nsv527082 CNV loss 19592680
nsv528375 CNV loss 19592680
nsv549494 CNV gain 21841781
nsv549495 CNV loss 21841781
nsv549496 CNV gain 21841781
nsv549511 CNV loss 21841781
nsv549512 CNV loss 21841781
nsv549519 CNV loss 21841781
nsv7191 OTHER inversion 18451855
nsv818877 CNV loss 17921354
nsv827698 CNV gain 20364138
nsv954011 CNV deletion 24416366
nsv956618 CNV deletion 24416366

Variation tolerance for KIF26B Gene

Residual Variation Intolerance Score: 94.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.93; 79.74% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KIF26B Gene

Human Gene Mutation Database (HGMD)
KIF26B
SNPedia medical, phenotypic, and genealogical associations of SNPs for
KIF26B

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KIF26B Gene

Disorders for KIF26B Gene

MalaCards: The human disease database

(1) MalaCards diseases for KIF26B Gene - From: HGMD and DISEASES

Disorder Aliases PubMed IDs
papillorenal syndrome
  • paprs
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for KIF26B

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with KIF26B: view

No data available for UniProtKB/Swiss-Prot and Genatlas for KIF26B Gene

Publications for KIF26B Gene

  1. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 43 56
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56
  3. VIRMA mediates preferential m6A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. (PMID: 29507755) Yue Y … Liu J (Cell discovery 2018) 3 56
  4. E3 ubiquitin ligase RNF123 targets lamin B1 and lamin-binding proteins. (PMID: 29676528) Khanna R … Parnaik VK (The FEBS journal 2018) 3 56
  5. Upregulation of KIF26B, Cell Migration and Proliferation of Human Ovarian Cancer Cell Lines In Vitro, and Patient Outcomes from Human Bioinformatic Analysis. (PMID: 29880787) Yang X … Xie L (Medical science monitor : international medical journal of experimental and clinical research 2018) 3 56

ExternalLinks

View latest publications for KIF26B gene in Mastermind

Products for KIF26B Gene

Sources for KIF26B Gene