Aliases for KIF26B Gene
External Ids for KIF26B Gene
- HGNC: 25484
- Entrez Gene: 55083
- Ensembl: ENSG00000162849
- OMIM: 614026
- UniProtKB: Q2KJY2
Previous GeneCards Identifiers for KIF26B Gene
- GC01P243384
- GC01P245318
- GC01P215701
Summaries for KIF26B Gene
-
The protein encoded by this gene is an intracellular motor protein thought to transport organelles along microtubules. The encoded protein is required for kidney development. Elevated levels of this protein have been found in some breast and colorectal cancers. [provided by RefSeq, Mar 2017]
GeneCards Summary for KIF26B Gene
KIF26B (Kinesin Family Member 26B) is a Protein Coding gene. Diseases associated with KIF26B include Papillorenal Syndrome. Among its related pathways are Response to elevated platelet cytosolic Ca2+ and Golgi-to-ER retrograde transport. Gene Ontology (GO) annotations related to this gene include ATPase activity and microtubule motor activity. An important paralog of this gene is KIF26A.
UniProtKB/Swiss-Prot for KIF26B Gene
-
Essential for embryonic kidney development. Plays an important role in the compact adhesion between mesenchymal cells adjacent to the ureteric buds, possibly by interacting with MYH10. This could lead to the establishment of the basolateral integrity of the mesenchyme and the polarized expression of ITGA8, which maintains the GDNF expression required for further ureteric bud attraction. Although it seems to lack ATPase activity it is constitutively associated with microtubules (By similarity).
Additional gene information for KIF26B Gene
- Monarch Initiative
- Search for KIF26B at DataMed
- Search for KIF26B at HumanCyc
No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KIF26B Gene
Genomics for KIF26B Gene
GeneHancer (GH) Regulatory Elements for KIF26B Gene
Promoters and enhancers for KIF26B Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around KIF26B on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Locations for KIF26B Gene
Genomic Locations for KIF26B Gene
- chr1:245,154,985-245,709,432
- (GRCh38/hg38)
- Size:
- 554,448 bases
- Orientation:
- Plus strand
- chr1:245,318,287-245,872,733
- (GRCh37/hg19)
Genomic View for KIF26B Gene
Genes around KIF26B on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1q44 by Ensembl
- 1q44 by Entrez Gene
- 1q44 by HGNC
KIF26B Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for KIF26B Gene
Proteins for KIF26B Gene
-
Protein details for KIF26B Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q2KJY2-KI26B_HUMAN
- Recommended name:
- Kinesin-like protein KIF26B
- Protein Accession:
- Q2KJY2
- Q6ZQR9
- Q6ZUZ0
- Q8IUN3
- Q8IVR1
- Q9NWB4
Protein attributes for KIF26B Gene
- Size:
- 2108 amino acids
- Molecular mass:
- 223883 Da
- Quaternary structure:
-
- Interacts with MYH10.
- SequenceCaution:
-
- Sequence=AAH42481.1; Type=Miscellaneous discrepancy; Note=Probable cloning artifact.; Evidence={ECO:0000305}; Sequence=BAA91469.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAC86076.1; Type=Miscellaneous discrepancy; Note=Aberrant splicing.; Evidence={ECO:0000305}; Sequence=BAC87614.1; Type=Miscellaneous discrepancy; Note=Intron retention.; Evidence={ECO:0000305};
Protein Expression for KIF26B Gene
Post-translational modifications for KIF26B Gene
- Phosphorylation at Thr-1855 and Ser-1958 by CDKs, mainly CDK2 and CDK5, enhances the interaction with NEDD4, polyubiquitination, and subsequent proteasomal degradation. Phosphorylation occurs upon loss of interaction with microtubules (By similarity).
- Polyubiquitinated by NEDD4, resulting in proteasomal degradation.
Other Protein References for KIF26B Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Novus Biologicals Antibodies for KIF26B
- Invitrogen Antibodies for KIF26B
- Search GeneTex for Antibodies for KIF26B
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for KIF26B
- Origene Custom Protein Services for KIF26B
- Novus Biologicals proteins for KIF26B
- Search GeneTex for Proteins for KIF26B
Assay Products
No data available for DME Specific Peptides for KIF26B Gene
Domains & Families for KIF26B Gene
Gene Families for KIF26B Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
Protein Domains for KIF26B Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for KIF26B Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q2KJY2UniProtKB/Swiss-Prot:
KI26B_HUMAN :- Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIF26 subfamily.
- Family:
-
- Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIF26 subfamily.
Function for KIF26B Gene
Molecular function for KIF26B Gene
- UniProtKB/Swiss-Prot Function:
- Essential for embryonic kidney development. Plays an important role in the compact adhesion between mesenchymal cells adjacent to the ureteric buds, possibly by interacting with MYH10. This could lead to the establishment of the basolateral integrity of the mesenchyme and the polarized expression of ITGA8, which maintains the GDNF expression required for further ureteric bud attraction. Although it seems to lack ATPase activity it is constitutively associated with microtubules (By similarity).
Phenotypes From GWAS Catalog for KIF26B Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003774 | motor activity | IEA | -- |
| GO:0003777 | microtubule motor activity | IEA,IBA | -- |
| GO:0005524 | ATP binding | IEA | -- |
| GO:0008017 | microtubule binding | IEA | -- |
| GO:0016887 | NOT ATPase activity | IBA | -- |
Phenotypes for KIF26B Gene
- MGI mutant phenotypes for KIF26B:
- inferred from 2 alleles
- GenomeRNAi human phenotypes for KIF26B:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for KIF26B
-
-
ViGene Biosciences lentiviral particle packaged cDNA for KIF26B gene
-
ViGene Biosciences ready-to-package AAV shRNAs for KIF26B gene
- Search ViGene Biosciences for KIF26B
CRISPR Products
-
OriGene CRISPR knockouts for KIF26B
- genomics-online: gRNA clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
- Applied Biological Materials CRISPR for KIF26B
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for KIF26B
- GenScript: Design CRISPR guide RNA sequences for KIF26B
miRNA for KIF26B Gene
- miRTarBase miRNAs that target KIF26B
-
- hsa-mir-4530 (MIRT536464)
- hsa-mir-5685 (MIRT536466)
- hsa-mir-4690-3p (MIRT536467)
- hsa-mir-634 (MIRT536468)
- hsa-mir-629-3p (MIRT656871)
- hsa-mir-3944-3p (MIRT656872)
- hsa-mir-627-3p (MIRT656873)
- hsa-mir-6795-3p (MIRT656874)
- hsa-mir-4279 (MIRT667704)
- hsa-mir-501-5p (MIRT667705)
- hsa-mir-20a-5p (MIRT732249)
miRNA Products
- Search ViGene Biosciences for KIF26B
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for KIF26B
- Browse OriGene Inhibitory RNA Products For KIF26B
- genomics-online: shRNA clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for KIF26B gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for KIF26B
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KIF26B
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for KIF26B
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for KIF26B
-
ViGene Biosciences adenoviral particle packaged cDNA for KIF26B gene
-
ViGene Biosciences lentiviral particle packaged cDNA for KIF26B gene
-
ViGene Biosciences ready-to-package AAV shRNAs for KIF26B gene
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KIF26B Gene
Localization for KIF26B Gene
Subcellular locations from UniProtKB/Swiss-Prot for KIF26B Gene
- Cytoplasm. Cytoplasm, cytoskeleton.
| Compartment | Confidence |
|---|---|
| cytoskeleton | 4 |
| plasma membrane | 3 |
| nucleus | 2 |
| mitochondrion | 1 |
| peroxisome | 1 |
| cytosol | 1 |
- Microtubules (2)
- Plasma membrane (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005737 | cytoplasm | IEA | -- |
| GO:0005856 | cytoskeleton | IEA | -- |
| GO:0005871 | kinesin complex | IBA | -- |
| GO:0005874 | microtubule | IEA | -- |
Pathways & Interactions for KIF26B Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Golgi-to-ER retrograde transport |
.52
|
|
| 2 | Vesicle-mediated transport | ||
| 3 | Factors involved in megakaryocyte development and platelet production | ||
| 4 | Response to elevated platelet cytosolic Ca2+ |
.44
|
|
Pathways by source for KIF26B Gene
Interacting Proteins for KIF26B Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0007018 | NOT microtubule-based movement | IEA,IBA | -- |
| GO:0007275 | multicellular organism development | IEA | -- |
| GO:0022409 | positive regulation of cell-cell adhesion | IEA | -- |
| GO:0030010 | establishment of cell polarity | IEA | -- |
| GO:0072092 | ureteric bud invasion | IEA | -- |
No data available for SIGNOR curated interactions for KIF26B Gene
Transcripts for KIF26B Gene
mRNA/cDNA for KIF26B Gene
- (3) REFSEQ mRNAs :
- (8) Additional mRNA sequences :
- (29) Selected AceView cDNA sequences:
- (4) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for KIF26B Gene
CRISPR Products
-
OriGene CRISPR knockouts for KIF26B
- genomics-online: gRNA clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
- Applied Biological Materials CRISPR for KIF26B
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for KIF26B
- GenScript: Design CRISPR guide RNA sequences for KIF26B
miRNA Products
- Search ViGene Biosciences for KIF26B
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for KIF26B
- Browse OriGene Inhibitory RNA Products For KIF26B
- genomics-online: shRNA clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for KIF26B gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for KIF26B
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KIF26B
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for KIF26B
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for KIF26B Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Kidney (Urinary System)
- Ureteric Bud Cells Ureteric Bud
- Metanephric Mesenchyme Cells Metanephric Mesenchyme
mRNA differential expression in normal tissues according to GTEx for KIF26B Gene
This gene is overexpressed in Brain - Cerebellar Hemisphere (x4.1).
This gene is overexpressed in Liver (38.0), Adipocyte (11.7), Monocytes (7.4), and Retina (7.2).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for KIF26B Gene
NURSA nuclear receptor signaling pathways regulating expression of KIF26B Gene:
KIF26BSOURCE GeneReport for Unigene cluster for KIF26B Gene:
Hs.368096Evidence on tissue expression from TISSUES for KIF26B Gene
- Blood(4.1)
- Nervous system(4.1)
Primer Products
-
OriGene qPCR primer pairs for KIF26B
-
OriGene qPCR primer pairs and template standards for KIF26B
No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for KIF26B Gene
Orthologs for KIF26B Gene
This gene was present in the common ancestor of animals and fungi.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | KIF26B 33 34 |
|
||
| cow (Bos Taurus) |
Mammalia | KIF26B 33 34 |
|
||
| dog (Canis familiaris) |
Mammalia | KIF26B 33 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Kif26b 33 |
|
||
| mouse (Mus musculus) |
Mammalia | Kif26b 33 16 34 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | KIF26B 34 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | KIF26B 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | KIF26B 33 34 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | KIF26B 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | kif26b 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | kif26ba 33 34 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | CG14535 34 |
|
OneToMany | |
| worm (Caenorhabditis elegans) |
Secernentea | vab-8 34 |
|
OneToMany | |
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | SMY1 34 |
|
OneToMany |
- Species where no ortholog for KIF26B was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for KIF26B Gene
(1) SIMAP similar genes for KIF26B Gene using alignment to 2 proteins:
Variants for KIF26B Gene
| SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs886037758 | pathogenic, not provided | 245,688,126(+) | GGGACCTCGCCCCCCAGCTCCGGGG/GGG | coding_sequence_variant, frameshift | |
| rs749953234 | uncertain-significance, not provided | 245,688,693(+) | G/A/C/T | coding_sequence_variant, missense_variant | |
| rs3806273 | benign, not specified | 245,687,204(+) | G/A/C/T | coding_sequence_variant, synonymous_variant | |
| rs3820246 | benign, not specified | 245,686,427(+) | G/A | coding_sequence_variant, synonymous_variant | |
| rs58427858 | benign, not specified | 245,687,987(+) | G/A/T | coding_sequence_variant, synonymous_variant |
Residual Variation Intolerance Score:
94.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
6.93;
79.74% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for KIF26B Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KIF26B Gene
Disorders for KIF26B Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| papillorenal syndrome |
|
|
Search KIF26B in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for KIF26B
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for KIF26B Gene
Publications for KIF26B Gene
- Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
- KIF26B, a novel oncogene, promotes proliferation and metastasis by activating the VEGF pathway in gastric cancer. (PMID: 28581513) Zhang H … Gao P (Oncogene 2017) 3 58
- Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
- HIV-host interactome revealed directly from infected cells. (PMID: 27375898) Luo Y … Muesing MA (Nature microbiology 2016) 3 58
Products for KIF26B Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for KIF26B
- Origene Custom Protein Services for KIF26B
- Origene shrna, sirna, and RNAi products in human, mouse, rat for KIF26B
- Browse OriGene Inhibitory RNA Products For KIF26B
- OriGene qPCR primer pairs and template standards for KIF26B
- OriGene qPCR primer pairs for KIF26B
- OriGene CRISPR knockouts for KIF26B
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For KIF26B
- GenScript: Next-day shipping of latest version cDNA ORF clones for KIF26B in any vector
- GenScript Custom Purified and Recombinant Proteins Services for KIF26B
- GenScript Custom Assay Services for KIF26B
- GenScript Custom overexpressing Cell Line Services for KIF26B
- GenScript: Design CRISPR guide RNA sequences for KIF26B
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for KIF26B
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for KIF26B
- Novus Biologicals proteins for KIF26B
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for KIF26B
- Cyagen custom Knockout/knockin (KOKI) mouse models for KIF26B
- VectorBuilder custom plasmid, inducible vectors for KIF26B
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KIF26B
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 18 available KIF26B Antibodies ranked by validation data
- Compare Top KIF26B Antibodies
- antibodies-online: Search results for available KIF26B related products ranked by validation data
- antibodies-online: Search results for available KIF26B related products ranked by validation data
- Search GeneTex for Antibodies for KIF26B
- Search GeneTex for Proteins for KIF26B
- ViGene Biosciences adenoviral particle packaged cDNA for KIF26B gene
- ViGene Biosciences lentiviral particle packaged cDNA for KIF26B gene
- ViGene Biosciences ready-to-package AAV shRNAs for KIF26B gene
- Search ViGene Biosciences for KIF26B
- Horizon Cell Lines for KIF26B
- genomics-online: cdna clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
- orf clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
- genomics-online: gRNA clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
- genomics-online: primer clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
- genomics-online: shRNA clones - Search results for 76 available KIF26B gene related products
- Overview of 76 available KIF26B gene related products
Sources for KIF26B Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew