Free for academic non-profit institutions. Other users need a Commercial license
The protein encoded by this gene is an intracellular motor protein thought to transport organelles along microtubules. The encoded protein is required for kidney development. Elevated levels of this protein have been found in some breast and colorectal cancers. [provided by RefSeq, Mar 2017]
KIF26B (Kinesin Family Member 26B) is a Protein Coding gene. Diseases associated with KIF26B include Papillorenal Syndrome. Among its related pathways are Vesicle-mediated transport and Golgi-to-ER retrograde transport. Gene Ontology (GO) annotations related to this gene include ATPase activity and microtubule motor activity. An important paralog of this gene is KIF26A.
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0003774 | motor activity | IEA | -- |
GO:0003777 | microtubule motor activity | IEA,IBA | 21873635 |
GO:0005524 | ATP binding | IEA | -- |
GO:0008017 | microtubule binding | IBA,IEA | 21873635 |
GO:0016887 | NOT ATPase activity | IBA | 21873635 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005737 | cytoplasm | IEA | -- |
GO:0005856 | cytoskeleton | IEA | -- |
GO:0005871 | kinesin complex | IBA | 21873635 |
GO:0005874 | microtubule | IBA | 21873635 |
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Golgi-to-ER retrograde transport |
.52
|
|
2 | Vesicle-mediated transport | ||
3 | Factors involved in megakaryocyte development and platelet production | ||
4 | Response to elevated platelet cytosolic Ca2+ |
.44
|
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0007018 | NOT microtubule-based movement | IBA,IEA | 21873635 |
GO:0007275 | multicellular organism development | IEA | -- |
GO:0022409 | positive regulation of cell-cell adhesion | IEA | -- |
GO:0030010 | establishment of cell polarity | IEA | -- |
GO:0072092 | ureteric bud invasion | IEA | -- |
This gene was present in the common ancestor of animals and fungi.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | KIF26B 33 32 |
|
OneToOne | |
cow (Bos Taurus) |
Mammalia | KIF26B 33 32 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | KIF26B 33 32 |
|
OneToOne | |
rat (Rattus norvegicus) |
Mammalia | Kif26b 32 |
|
||
mouse (Mus musculus) |
Mammalia | Kif26b 17 33 32 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | KIF26B 33 |
|
OneToOne | |
platypus (Ornithorhynchus anatinus) |
Mammalia | KIF26B 33 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | KIF26B 33 32 |
|
OneToOne | |
lizard (Anolis carolinensis) |
Reptilia | KIF26B 33 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | kif26b 32 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | kif26ba 33 32 |
|
OneToOne | |
fruit fly (Drosophila melanogaster) |
Insecta | CG14535 33 |
|
OneToMany | |
worm (Caenorhabditis elegans) |
Secernentea | vab-8 33 |
|
OneToMany | |
baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | SMY1 33 |
|
OneToMany |
SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs749953234 | uncertain-significance, not provided, - | 245,688,693(+) | G/A/C/T | coding_sequence_variant, missense_variant | |
rs886037758 | pathogenic, not provided | 245,688,126(+) | GGGACCTCGCCCCCCAGCTCCGGGG/GGG | coding_sequence_variant, frameshift | |
rs3806273 | benign, not specified | 245,687,204(+) | G/A/C/T | coding_sequence_variant, synonymous_variant | |
rs3820246 | benign, not specified | 245,686,427(+) | G/A | coding_sequence_variant, synonymous_variant | |
rs58427858 | benign, not specified | 245,687,987(+) | G/A/T | coding_sequence_variant, synonymous_variant |
Disorder | Aliases | PubMed IDs |
---|---|---|
papillorenal syndrome |
|
|