Aliases for KCTD15 Gene

Aliases for KCTD15 Gene

  • Potassium Channel Tetramerization Domain Containing 15 2 3 5
  • Potassium Channel Tetramerization Domain-Containing Protein 15 3 4
  • Potassium Channel Tetramerisation Domain Containing 15 2 3
  • BTB/POZ Domain-Containing Protein KCTD15 3 4

External Ids for KCTD15 Gene

Previous GeneCards Identifiers for KCTD15 Gene

  • GC19P038979
  • GC19P034287
  • GC19P030786

Summaries for KCTD15 Gene

GeneCards Summary for KCTD15 Gene

KCTD15 (Potassium Channel Tetramerization Domain Containing 15) is a Protein Coding gene. Among its related pathways are Activation of cAMP-Dependent PKA and Sweet Taste Signaling. An important paralog of this gene is KCTD1.

UniProtKB/Swiss-Prot Summary for KCTD15 Gene

  • During embryonic development, interferes with neural crest formation (By similarity). Inhibits AP2 transcriptional activity by interaction with its activation domain.

Gene Wiki entry for KCTD15 Gene

Additional gene information for KCTD15 Gene

No data available for Entrez Gene Summary , CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for KCTD15 Gene

Genomics for KCTD15 Gene

GeneHancer (GH) Regulatory Elements for KCTD15 Gene

Promoters and enhancers for KCTD15 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19J033794 Promoter/Enhancer 2.7 UCNEbase EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 759.8 +1.2 1182 5.9 ZNF785 SIN3A ZBTB40 CTCF ZBTB6 POLR2A TCF7L2 ELF1 L3MBTL2 RAD21 KCTD15 lnc-CHST8-1 lnc-PEPD-4 ZNF599 ZNF302 GPATCH1 CEP89 ZNF181 LSM14A KIAA0355
GH19J033819 Enhancer 1.4 FANTOM5 ENCODE dbSUPER 19.4 +24.7 24710 2.8 ZNF785 ZBTB6 POLR2A ZNF701 HLF L3MBTL2 ZNF121 MNT ZFX CEBPG GPATCH1 CEP89 ZNF599 LSM14A KIAA0355 ZNF302 ZNF181 ENSG00000267219 ENSG00000270281 KCTD15
GH19J033803 Enhancer 1.1 Ensembl ENCODE dbSUPER 9.8 +8.2 8212 2.1 SIN3A FOXA1 RBPJ CREB1 SREBF1 ZBTB33 ELF3 SP1 MAFK ZNF644 KCTD15 lnc-PEPD-2 piR-50877
GH19J033816 Enhancer 0.5 dbSUPER 18.3 +20.2 20204 0.9 SP7 PRDM10 POLR2A FOSL1 ZNF18 ZFHX2 KLF17 FOS KLF1 KCTD15 lnc-CHST8-3 lnc-PEPD-7
GH19J033767 Enhancer 0.8 ENCODE 12.4 -27.9 -27882 0.2 MIXL1 HLF ELF3 AHR TFE3 PPARG REST ZNF143 ZNF7 RXRB KCTD15 HSALNG0125445 CHST8
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around KCTD15 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KCTD15 gene promoter:
  • aMEF-2
  • En-1
  • IRF-7A
  • MEF-2A
  • SRF
  • SRF (504 AA)
  • Tal-1beta
  • TBP

Genomic Locations for KCTD15 Gene

Genomic Locations for KCTD15 Gene
19,831 bases
Plus strand
19,831 bases
Plus strand

Genomic View for KCTD15 Gene

Genes around KCTD15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KCTD15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KCTD15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KCTD15 Gene

Proteins for KCTD15 Gene

  • Protein details for KCTD15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    BTB/POZ domain-containing protein KCTD15
    Protein Accession:
    Secondary Accessions:
    • A8K600
    • Q9BVI6

    Protein attributes for KCTD15 Gene

    283 amino acids
    Molecular mass:
    31942 Da
    Quaternary structure:
    • Interacts with TFAP2A; this interaction inhibits TFAP2A transcriptional activation.

    Alternative splice isoforms for KCTD15 Gene


neXtProt entry for KCTD15 Gene

Post-translational modifications for KCTD15 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Antibody Products

  • Abcam antibodies for KCTD15

No data available for DME Specific Peptides for KCTD15 Gene

Domains & Families for KCTD15 Gene

Gene Families for KCTD15 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for KCTD15 Gene

Suggested Antigen Peptide Sequences for KCTD15 Gene

GenScript: Design optimal peptide antigens:
  • BTB/POZ domain-containing protein KCTD15 (KCD15_HUMAN)
genes like me logo Genes that share domains with KCTD15: view

No data available for Graphical View of Domain Structure and UniProtKB/Swiss-Prot for KCTD15 Gene

Function for KCTD15 Gene

Molecular function for KCTD15 Gene

UniProtKB/Swiss-Prot Function:
During embryonic development, interferes with neural crest formation (By similarity). Inhibits AP2 transcriptional activity by interaction with its activation domain.

Phenotypes From GWAS Catalog for KCTD15 Gene

Gene Ontology (GO) - Molecular Function for KCTD15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25416956
GO:0042802 identical protein binding IPI 27152988
genes like me logo Genes that share ontologies with KCTD15: view
genes like me logo Genes that share phenotypes with KCTD15: view

Animal Models for KCTD15 Gene

MGI Knock Outs for KCTD15:
  • Kctd15 Kctd15<tm1b(EUCOMM)Wtsi>

Animal Model Products

  • Taconic Biosciences Mouse Models for KCTD15

CRISPR Products

miRNA for KCTD15 Gene

miRTarBase miRNAs that target KCTD15

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for KCTD15

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KCTD15 Gene

Localization for KCTD15 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KCTD15 gene
Compartment Confidence
nucleus 3
golgi apparatus 2
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
  • Nucleoplasm (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for KCTD15 Gene

Pathways & Interactions for KCTD15 Gene

PathCards logo

SuperPathways for KCTD15 Gene

SuperPathway Contained pathways
1 Sweet Taste Signaling
2 Activation of cAMP-Dependent PKA
3 Neuropathic Pain-Signaling in Dorsal Horn Neurons
4 Hepatic ABC Transporters
5 Gene Expression
genes like me logo Genes that share pathways with KCTD15: view

Pathways by source for KCTD15 Gene

13 Qiagen pathways for KCTD15 Gene
  • Activation of cAMP-Dependent PKA
  • Aldosterone Signaling in Epithelial Cells
  • Bitter Taste Signaling
  • cAMP Pathway
  • Cellular Effects of Sildenafil

Gene Ontology (GO) - Biological Process for KCTD15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007275 multicellular organism development IEA --
GO:0051260 protein homooligomerization IEA --
genes like me logo Genes that share ontologies with KCTD15: view

No data available for SIGNOR curated interactions for KCTD15 Gene

Drugs & Compounds for KCTD15 Gene

No Compound Related Data Available

Transcripts for KCTD15 Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for KCTD15

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for KCTD15 Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b · 3c ^ 4a · 4b ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b · 8c ^ 9a · 9b · 9c · 9d ^ 10 ^ 11a · 11b
SP1: - - - -
SP2: - -
SP3: - - - - - - - - -
SP4: - - - - - - -
SP5: - - - - - -
SP6: - -
SP7: - - - -
SP8: - - -
SP9: -

Relevant External Links for KCTD15 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KCTD15 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KCTD15 Gene

Protein differential expression in normal tissues from HIPED for KCTD15 Gene

This gene is overexpressed in Fetal Brain (17.1), Urinary Bladder (13.7), Fetal heart (12.7), Retina (12.0), and Esophagus (9.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for KCTD15 Gene

Protein tissue co-expression partners for KCTD15 Gene

NURSA nuclear receptor signaling pathways regulating expression of KCTD15 Gene:


SOURCE GeneReport for Unigene cluster for KCTD15 Gene:


Evidence on tissue expression from TISSUES for KCTD15 Gene

  • Nervous system(4.6)
genes like me logo Genes that share expression patterns with KCTD15: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for KCTD15 Gene

Orthologs for KCTD15 Gene

This gene was present in the common ancestor of animals.

Orthologs for KCTD15 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia KCTD15 33 32
  • 99.53 (n)
(Bos Taurus)
Mammalia KCTD15 33 32
  • 93.99 (n)
(Canis familiaris)
Mammalia KCTD15 33 32
  • 93.4 (n)
(Ornithorhynchus anatinus)
Mammalia KCTD15 33
  • 91 (a)
(Monodelphis domestica)
Mammalia KCTD15 33
  • 91 (a)
(Rattus norvegicus)
Mammalia Kctd15 32
  • 90.22 (n)
(Mus musculus)
Mammalia Kctd15 17 33 32
  • 88.46 (n)
(Gallus gallus)
Aves KCTD15 33 32
  • 74.97 (n)
(Anolis carolinensis)
Reptilia KCTD15 33
  • 79 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia kctd15 32
  • 74.38 (n)
MGC76138 32
(Danio rerio)
Actinopterygii kctd15a 33
  • 88 (a)
kctd15b 32
  • 81.32 (n)
KCTD15 (2 of 2) 33
  • 78 (a)
Dr.15592 32
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP007044 32
  • 62.59 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG10440 33 32
  • 60.71 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 37 (a)
Species where no ortholog for KCTD15 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for KCTD15 Gene

Gene Tree for KCTD15 (if available)
Gene Tree for KCTD15 (if available)
Evolutionary constrained regions (ECRs) for KCTD15: view image

Paralogs for KCTD15 Gene

(5) SIMAP similar genes for KCTD15 Gene using alignment to 7 proteins:

  • K7EM48_HUMAN
  • K7EN63_HUMAN
genes like me logo Genes that share paralogs with KCTD15: view

Variants for KCTD15 Gene

Sequence variations from dbSNP and Humsavar for KCTD15 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1000205617 -- 33,812,689(+) G/A 3_prime_UTR_variant, genic_downstream_transcript_variant, intron_variant
rs1000225232 -- 33,797,053(+) C/G genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000313717 -- 33,800,927(+) T/C genic_downstream_transcript_variant, intron_variant
rs1000438558 -- 33,796,823(+) GAGGGGTGGGTGGGGGGAGGGTTGGGGGCGAGAG/GAG 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000620068 -- 33,806,452(+) T/C genic_downstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for KCTD15 Gene

Variant ID Type Subtype PubMed ID
dgv139e55 CNV gain 17911159
esv2758755 CNV gain 17122850
nsv2464 CNV insertion 18451855
nsv579339 CNV gain 21841781
nsv828528 CNV gain 20364138
nsv833809 CNV loss 17160897
nsv953278 CNV deletion 24416366

Variation tolerance for KCTD15 Gene

Residual Variation Intolerance Score: 41.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.74; 15.74% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KCTD15 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KCTD15 Gene

Disorders for KCTD15 Gene

Additional Disease Information for KCTD15

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for KCTD15 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KCTD15 Gene

Publications for KCTD15 Gene

  1. The essential player in adipogenesis GRP78 is a novel KCTD15 interactor. (PMID: 29665387) Smaldone G … Pedone E (International journal of biological macromolecules 2018) 2 3 56
  2. Inhibition of neural crest formation by Kctd15 involves regulation of transcription factor AP-2. (PMID: 23382213) Zarelli VE … Dawid IB (Proceedings of the National Academy of Sciences of the United States of America 2013) 3 4 56
  3. Evaluating the discriminative power of multi-trait genetic risk scores for type 2 diabetes in a northern Swedish population. (PMID: 20571754) Fontaine-Bisson B … Franks PW (Diabetologia 2010) 3 43 56
  4. Analyses of shared genetic factors between asthma and obesity in children. (PMID: 20816195) Melén E … Lasky-Su J (The Journal of allergy and clinical immunology 2010) 3 43 56
  5. Obesity and diabetes genes are associated with being born small for gestational age: results from the Auckland Birthweight Collaborative study. (PMID: 20712903) Morgan AR … Mitchell EA (BMC medical genetics 2010) 3 43 56

Products for KCTD15 Gene

Sources for KCTD15 Gene