Aliases for ITM2B Gene
Aliases for ITM2B Gene
External Ids for ITM2B Gene
- HGNC: 6174
- Entrez Gene: 9445
- Ensembl: ENSG00000136156
- OMIM: 603904
- UniProtKB: Q9Y287
Previous GeneCards Identifiers for ITM2B Gene
- GC13P046807
- GC13P042794
- GC13P047743
- GC13P046605
- GC13P046602
- GC13P047705
- GC13P048807
- GC13P029600
Summaries for ITM2B Gene
-
Amyloid precursor proteins are processed by beta-secretase and gamma-secretase to produce beta-amyloid peptides which form the characteristic plaques of Alzheimer disease. This gene encodes a transmembrane protein which is processed at the C-terminus by furin or furin-like proteases to produce a small secreted peptide which inhibits the deposition of beta-amyloid. Mutations which result in extension of the C-terminal end of the encoded protein, thereby increasing the size of the secreted peptide, are associated with two neurogenerative diseases, familial British dementia and familial Danish dementia. [provided by RefSeq, Oct 2009]
GeneCards Summary for ITM2B Gene
ITM2B (Integral Membrane Protein 2B) is a Protein Coding gene. Diseases associated with ITM2B include Retinal Dystrophy With Inner Retinal Dysfunction And Ganglion Cell Abnormalities and Cerebral Amyloid Angiopathy, Itm2b-Related, 2. Among its related pathways are Metabolism of proteins and Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3. Gene Ontology (GO) annotations related to this gene include amyloid-beta binding. An important paralog of this gene is ITM2C.
UniProtKB/Swiss-Prot for ITM2B Gene
-
Plays a regulatory role in the processing of the amyloid-beta A4 precursor protein (APP) and acts as an inhibitor of the amyloid-beta peptide aggregation and fibrils deposition. Plays a role in the induction of neurite outgrowth. Functions as a protease inhibitor by blocking access of secretases to APP cleavage sites.
-
Mature BRI2 (mBRI2) functions as a modulator of the amyloid-beta A4 precursor protein (APP) processing leading to a strong reduction in the secretion of secretase-processed amyloid-beta protein 40 and amyloid-beta protein 42.
-
Bri23 peptide prevents aggregation of APP amyloid-beta protein 42 into toxic oligomers.
Additional gene information for ITM2B Gene
- Monarch Initiative
- Search for ITM2B at DataMed
- Search for ITM2B at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ITM2B Gene
Genomics for ITM2B Gene
GeneHancer (GH) Regulatory Elements for ITM2B Gene
Promoters and enhancers for ITM2B Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)
GeneHancers around ITM2B on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the ITM2B gene promoter:
-
- AP-2gamma
- AP-2beta
- AP-2alphaA
- AP-2alpha
- Ik-2
- Brachyury
- POU2F1a
- POU2F1
- Ik-1
- c-Rel
Regulatory Element Products
Genomic Locations for ITM2B Gene
Genomic Locations for ITM2B Gene
- chr13:48,233,138-48,270,357
- (GRCh38/hg38)
- Size:
- 37,220 bases
- Orientation:
- Plus strand
- chr13:48,807,274-48,837,063
- (GRCh37/hg19)
- Size:
- 29,790 bases
- Orientation:
- Plus strand
Genomic View for ITM2B Gene
Genes around ITM2B on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 13q14.2 by Entrez Gene
- 13q14.2 by HGNC
- 13q14.2 by Ensembl
ITM2B Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for ITM2B Gene
Proteins for ITM2B Gene
-
Protein details for ITM2B Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9Y287-ITM2B_HUMAN
- Recommended name:
- Integral membrane protein 2B
- Protein Accession:
- Q9Y287
- Q5W0A3
- Q96B24
- Q9NYH1
Protein attributes for ITM2B Gene
- Size:
- 266 amino acids
- Molecular mass:
- 30338 Da
- Quaternary structure:
-
- Homodimer; disulfide-linked. Interacts with SPPL2A and SPPL2B. Interacts with APP. Mature BRI2 (mBRI2) interacts with the APP amyloid-beta A4 protein; the interaction occurs at the cell surface and in the endocytic compartments and enable alpha- and beta-secretase-induced APP cleavage inhibition. Mature BRI2 (mBRI2) interacts with the APP C99; the interaction occurs in the endocytic compartments and enable gamma-secretase-induced C99 cleavage inhibition. May form heterodimers with Bri23 peptide and APP amyloid-beta protein 40.
Protein Expression for ITM2B Gene
Post-translational modifications for ITM2B Gene
- The ectodomain C-terminal part of the imBRI2 is processed by furin producing a secreted Bri23 peptide and a mature BRI2, membrane form (mBRI2). The remaining part of the ectodomain of mBRI2 containing the BRICHOS domain is cleaved by ADAM10 and is secreted (BRI2C, soluble form). The membrane-bound N-terminal fragment (BRI2C, membrane form) is further proteolytically processed by SPPL2A and SPPL2B through regulated intramembrane proteolysis producing a secreted C-peptide and a BRI2 intracellular domain (BRI2 ICD) released in the cytosol. Shedding by ADAM10 facilitates intramembrane cleavage but is not absolutely required for BRI2 ICD generation.
- Glycosylation at Asn-170 is important for cell surface localization, but doesnt affect furin- and ADAM10-induced proteolytic processing.
- Glycosylation at isoforms=170
- Ubiquitination at Lys13 and Lys3
- Modification sites at PhosphoSitePlus
Other Protein References for ITM2B Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for ITM2B (ITM2B)
- Novus Biologicals Antibodies for ITM2B
-
Abcam antibodies for ITM2B
- Invitrogen Antibodies for ITM2B (AFLGC-ITM2B)
- GeneTex ITM2B Antibody for ITM2B
-
Santa Cruz Biotechnology (SCBT) Antibodies for ITM2B
Protein Products
-
OriGene Purified Proteins for ITM2B
- Search Origene for MassSpec and Protein Over-expression Lysates for ITM2B
- Origene Custom Protein Services for ITM2B
- Search GeneTex for Proteins for ITM2B
-
ProSci Proteins for ITM2B
-
Abcam proteins for ITM2B
Assay Products
- antibodies-online: Search results for 1 available ITM2B Elisa Kits ranked by validation data
- Compare Top ITM2B Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for ITM2B Gene
Domains & Families for ITM2B Gene
Gene Families for ITM2B Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Predicted membrane proteins
Protein Domains for ITM2B Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for ITM2B Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q9Y287- Family:
-
- Belongs to the ITM2 family.
Function for ITM2B Gene
Molecular function for ITM2B Gene
- UniProtKB/Swiss-Prot Function:
- Plays a regulatory role in the processing of the amyloid-beta A4 precursor protein (APP) and acts as an inhibitor of the amyloid-beta peptide aggregation and fibrils deposition. Plays a role in the induction of neurite outgrowth. Functions as a protease inhibitor by blocking access of secretases to APP cleavage sites.
- UniProtKB/Swiss-Prot Function:
- Mature BRI2 (mBRI2) functions as a modulator of the amyloid-beta A4 precursor protein (APP) processing leading to a strong reduction in the secretion of secretase-processed amyloid-beta protein 40 and amyloid-beta protein 42.
- UniProtKB/Swiss-Prot Function:
- Bri23 peptide prevents aggregation of APP amyloid-beta protein 42 into toxic oligomers.
- GENATLAS Biochemistry:
- integral membrane protein type 2B,ubiquitously expressed
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001540 | amyloid-beta binding | IPI | 19849849 |
| GO:0005515 | protein binding | IPI | 16027166 |
| GO:0005524 | ATP binding | IEA | -- |
Phenotypes for ITM2B Gene
- MGI mutant phenotypes for ITM2B:
- inferred from 4 alleles
- GenomeRNAi human phenotypes for ITM2B:
Animal Models for ITM2B Gene
- MGI Knock Outs for ITM2B:
-
- Itm2b Itm2b<tm1.1Ldad>
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for ITM2B
-
CRISPR Products
-
OriGene CRISPR knockouts for ITM2B
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for ITM2B
- genomics-online: gRNA clones - Search results for available ITM2B gene related products
- Applied Biological Materials CRISPR for ITM2B
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for ITM2B
- GenScript: Design CRISPR guide RNA sequences for ITM2B
miRNA for ITM2B Gene
- miRTarBase miRNAs that target ITM2B
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for ITM2B
- Browse OriGene Inhibitory RNA Products For ITM2B
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ITM2B
- genomics-online: shRNA clones - Search results for available ITM2B gene related products
Clone Products
- Sino Biological Human cDNA Clone for ITM2B
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for ITM2B
- genomics-online: cdna clones - Search results for available ITM2B gene related products
- orf clones - Search results for available ITM2B gene related products
- Applied Biological Materials Clones for ITM2B
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for ITM2B
No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Transcription Factor Targets and HOMER Transcription for ITM2B Gene
Localization for ITM2B Gene
Subcellular locations from UniProtKB/Swiss-Prot for ITM2B Gene
- Integral membrane protein 2B: Golgi apparatus membrane; Single-pass type II membrane protein. Note=Immature BRI2 (imBRI2) is cleaved by furin in the Golgi into mBRI2 and a Bri23 peptide. mBRI2 is transported to the plasma membrane and Bri23 peptide is secreted.
- BRI2, membrane form: Cell membrane; Single-pass type II membrane protein. Endosome membrane; Single-pass type II membrane protein. Note=Mature BRI2 (mBRI2) needs to be transported from the endoplasmic reticulum compartment to the cell membrane in order to be able to inhibit APP processing. {ECO:0000269 PubMed:19748705}.
- Bri23 peptide: Secreted. Note=Detected in the cerebral spinal fluid (CSF). {ECO:0000269 PubMed:18524908}.
- BRI2C, soluble form: Secreted.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| extracellular | 5 |
| golgi apparatus | 5 |
| endosome | 3 |
- Golgi apparatus (4)
- Vesicles (4)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000139 | Golgi membrane | IEA | -- |
| GO:0005576 | extracellular region | TAS | -- |
| GO:0005615 | extracellular space | IDA | 18524908 |
| GO:0005768 | endosome | IEA | -- |
| GO:0005794 | Golgi apparatus | IDA,IEA | -- |
Pathways & Interactions for ITM2B Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 | ||
| 2 | Metabolism of proteins | ||
Pathways by source for ITM2B Gene
2 Reactome pathways for ITM2B Gene
Interacting Proteins for ITM2B Gene
Selected Interacting proteins:
ENSP00000367828
Q9Y287-ITM2B_HUMAN
for ITM2B Gene via
STRING
IID
MINT
UniProtKB
GPS-Prot Interaction Network for ITM2B
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0007399 | nervous system development | TAS | 10391242 |
| GO:0042985 | negative regulation of amyloid precursor protein biosynthetic process | IDA | 16027166 |
| GO:0044267 | cellular protein metabolic process | TAS | -- |
| GO:0097192 | extrinsic apoptotic signaling pathway in absence of ligand | IEA | -- |
No data available for SIGNOR curated interactions for ITM2B Gene
Transcripts for ITM2B Gene
mRNA/cDNA for ITM2B Gene
- (1) REFSEQ mRNAs :
- (13) Additional mRNA sequences :
- (1389) Selected AceView cDNA sequences:
- (4) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000378565 10137 bps (uc001vbz.4)
- ENST00000378549 805 bps (uc058wyb.1)
- ENST00000607866 596 bps (uc058wyc.1)
- ENST00000463839 810 bps (uc058wyd.1)
Unigene Clusters for ITM2B Gene
CRISPR Products
-
OriGene CRISPR knockouts for ITM2B
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for ITM2B
- genomics-online: gRNA clones - Search results for available ITM2B gene related products
- Applied Biological Materials CRISPR for ITM2B
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for ITM2B
- GenScript: Design CRISPR guide RNA sequences for ITM2B
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for ITM2B
- Browse OriGene Inhibitory RNA Products For ITM2B
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ITM2B
- genomics-online: shRNA clones - Search results for available ITM2B gene related products
Clone Products
- Sino Biological Human cDNA Clone for ITM2B
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for ITM2B
- genomics-online: cdna clones - Search results for available ITM2B gene related products
- orf clones - Search results for available ITM2B gene related products
- Applied Biological Materials Clones for ITM2B
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
| ExUns: | 1a | · | 1b | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6a | · | 6b | ^ | 7 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | ||||||||||||||||
| SP2: | |||||||||||||||||
| SP3: | - | - | - |
Expression for ITM2B Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Brain (Nervous System)
-
Blood (Hematopoietic System)
- Granulocytes Peripheral Blood
- Neural Tube (Nervous System)
- Intestine (Gastrointestinal Tract)
- Bone (Muscoskeletal System)
-
Uterus (Reproductive System)
-
Colon (Gastrointestinal Tract)
-
Prostate (Endocrine System)
-
Placenta (Extraembryonic Tissues)
-
Spleen (Hematopoietic System)
-
Thyroid (Endocrine System)
-
Gall Bladder (Hepatobiliary System)
-
Lung (Respiratory System)
-
Kidney (Urinary System)
-
Testis (Reproductive System)
-
Adrenal Gland (Endocrine System)
-
Esophagus (Gastrointestinal Tract)
-
Stomach (Gastrointestinal Tract)
-
Liver (Hepatobiliary System)
-
Pancreas (Endocrine System)
-
Ovary (Reproductive System)
-
Adipose (Muscoskeletal System)
mRNA differential expression in normal tissues according to GTEx for ITM2B Gene
This gene is overexpressed in Whole Blood (x6.7).
This gene is overexpressed in Amniocyte (31.2) and Urine (30.1).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for ITM2B Gene
NURSA nuclear receptor signaling pathways regulating expression of ITM2B Gene:
ITM2BSOURCE GeneReport for Unigene cluster for ITM2B Gene:
Hs.643683mRNA Expression by UniProt/SwissProt for ITM2B Gene:
Q9Y287-ITM2B_HUMAN
Tissue specificity:
Ubiquitous. Expressed in brain.
Evidence on tissue expression from TISSUES for ITM2B Gene
- Nervous system(5)
- Adrenal gland(4.6)
- Lung(4.3)
- Kidney(4.2)
- Liver(4.2)
- Intestine(3.6)
- Pancreas(3.6)
- Eye(3.4)
- Blood(3)
- Spleen(2.7)
- Stomach(2.7)
- Heart(2.6)
- Gall bladder(2.5)
- Thyroid gland(2.5)
- Muscle(2.4)
- Skin(2.4)
- Lymph node(2.3)
- Bone marrow(2)
Phenotype-based relationships between genes and organs from Gene ORGANizer for ITM2B Gene
Germ Layers:
- ectoderm
- mesoderm
Systems:
- nervous
- skeletal muscle
Regions:
Head and neck:
- brain
- cerebellum
- cranial nerve
- ear
- eye
- head
General:
- blood vessel
- peripheral nervous system
- spinal cord
Primer Products
-
OriGene qPCR primer pairs for ITM2B
-
OriGene qPCR primer pairs and template standards for ITM2B
- genomics-online: primer clones - Search results for available ITM2B gene related products
Gene Expression Assay Products
No data available for Protein tissue co-expression partners for ITM2B Gene
Orthologs for ITM2B Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | ITM2B 34 33 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | ITM2B 34 33 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | ITM2B 34 33 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | ITM2B 34 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Itm2b 33 |
|
||
| mouse (Mus musculus) |
Mammalia | Itm2b 16 34 33 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | ITM2B 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | ITM2B 34 33 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | ITM2B 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | itm2b 33 |
|
||
| MGC76131 33 |
|
||||
| African clawed frog (Xenopus laevis) |
Amphibia | itm2b-prov 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | itm2ba 34 33 |
|
OneToMany | |
| itm2bb 34 |
|
OneToMany | |||
| wufc05f02 33 |
|
||||
| rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.10389 33 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | CG3662 34 |
|
OneToMany | |
| worm (Caenorhabditis elegans) |
Secernentea | C25F6.7 34 |
|
OneToMany |
- Species where no ortholog for ITM2B was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for ITM2B Gene
- ENSEMBL:
- Gene Tree for ITM2B (if available)
- TreeFam:
- Gene Tree for ITM2B (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for ITM2B: view image
Paralogs for ITM2B Gene
(8) SIMAP similar genes for ITM2B Gene using alignment to 6 proteins:
- ITM2B_HUMAN
- Q5W0A2_HUMAN
- Q5W0A3_HUMAN
- Q96B24_HUMAN
- U3KQ52_HUMAN
- U3KQL7_HUMAN
Pseudogenes.org Pseudogenes for ITM2B Gene
Variants for ITM2B Gene
| SNP ID | Clin | Chr 13 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs104894417 | pathogenic, Dementia familial British | 48,261,222(+) | T/A | stop_lost, terminator_codon_variant | |
| rs606231166 | pathogenic, Dementia, familial Danish | 48,261,209(+) | TTTAATTTGTT/TTTAATTTGTTTTAATTTGTT | coding_sequence_variant, frameshift | |
| rs606231283 | pathogenic, Retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities, Retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities (RDGCA) [MIM:616079] | 48,261,205(+) | A/C | coding_sequence_variant, missense_variant | |
| rs1000166839 | -- | 48,252,081(+) | T/C | intron_variant | |
| rs1000205858 | -- | 48,235,251(+) | C/T | intron_variant |
Residual Variation Intolerance Score:
42.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
2.82;
47.80% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for ITM2B Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for ITM2B Gene
Disorders for ITM2B Gene
(10) MalaCards diseases for ITM2B Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities |
|
|
| cerebral amyloid angiopathy, itm2b-related, 2 |
|
|
| cerebral amyloid angiopathy, itm2b-related, 1 |
|
|
| dementia |
|
|
| functional diarrhea |
|
|
Search ITM2B in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
ITM2B_HUMAN- Cerebral amyloid angiopathy, ITM2B-related 1 (CAA-ITM2B1) [MIM:176500]: A disorder characterized by amyloid deposition in the walls of cerebral blood vessels and neurodegeneration in the central nervous system. Cerebral amyloid angiopathy, non-neuritic and perivascular plaques and neurofibrillary tangles are the predominant pathological lesions. Clinical features include progressive mental deterioration, spasticity and muscular rigidity. {ECO:0000269 PubMed:10391242, ECO:0000269 PubMed:10526337, ECO:0000269 PubMed:14656991}. Note=The disease is caused by mutations affecting the gene represented in this entry. A single base substitution at the stop codon of ITM2B generates a 277-residue precursor that is cleaved at the normal furin processing site to generate the ABri amyloidogenic peptide (PubMed:10391242). ABri accumulates in the brain and produces amyloid fibrils responsible for neuronal dysfunction and dementia. ABri peptide variant forms fibrils in vitro (PubMed:10526337). {ECO:0000269 PubMed:10391242, ECO:0000269 PubMed:10526337}.
- Cerebral amyloid angiopathy, ITM2B-related 2 (CAA-ITM2B2) [MIM:117300]: A disorder characterized by amyloid deposition in the walls of the blood vessels of the cerebrum, choroid plexus, cerebellum, spinal cord and retina. Plaques and neurofibrillary tangles are observed in the hippocampus. Clinical features include progressive ataxia, dementia, cataracts and deafness. {ECO:0000269 PubMed:10781099, ECO:0000269 PubMed:14656991, ECO:0000269 PubMed:16091362}. Note=The disease is caused by mutations affecting the gene represented in this entry. A decamer duplication in the 3 region of ITM2B results in the production of the ADan amyloidogenic peptide (PubMed:10781099). ADan is generated by cleavage of the mutated precursor at the normal furin processing site. ADan accumulates in the brain and produces amyloid fibrils responsible for neuronal dysfunction and dementia. {ECO:0000269 PubMed:10781099}.
- Retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities (RDGCA) [MIM:616079]: An autosomal dominant retinal dystrophy characterized by inner retinal dysfunction in association with ganglion cell abnormalities. Clinical features include mild photophobia, progressive loss of central vision, night blindness, and hyperreflectivity of nerve and ganglion cell layers. {ECO:0000269 PubMed:24026677}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for ITM2B
No data available for Genatlas for ITM2B Gene
Publications for ITM2B Gene
- BRI2 homodimerizes with the involvement of intermolecular disulfide bonds. (PMID: 18440095) Tsachaki M … Efthimiopoulos S (Neurobiology of aging 2010) 3 4 22 58
- Regulated intramembrane proteolysis of Bri2 (Itm2b) by ADAM10 and SPPL2a/SPPL2b. (PMID: 17965014) Martin L … Haass C (The Journal of biological chemistry 2008) 3 4 22 58
- The familial dementia BRI2 gene binds the Alzheimer gene amyloid-beta precursor protein and inhibits amyloid-beta production. (PMID: 15983050) Matsuda S … D'Adamio L (The Journal of biological chemistry 2005) 3 4 22 58
- BRI2 interacts with amyloid precursor protein (APP) and regulates amyloid beta (Abeta) production. (PMID: 16027166) Fotinopoulou A … Efthimiopoulos S (The Journal of biological chemistry 2005) 3 4 22 58
- Axonal transport of British and Danish amyloid peptides via secretory vesicles. (PMID: 14656991) Choi SI … Levy E (FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2004) 3 4 22 58
Products for ITM2B Gene
- R&D Systems Antibodies for ITM2B (ITM2B)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for ITM2B
- Search Origene for MassSpec and Protein Over-expression Lysates for ITM2B
- Origene Custom Protein Services for ITM2B
- Origene shrna, sirna, and RNAi products in human, mouse, rat for ITM2B
- Browse OriGene Inhibitory RNA Products For ITM2B
- OriGene qPCR primer pairs for ITM2B
- OriGene qPCR primer pairs and template standards for ITM2B
- OriGene CRISPR knockouts for ITM2B
- OriGene ORF clones in human for ITM2B
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For ITM2B
- GenScript: Next-day shipping of latest version cDNA ORF clones for ITM2B in any vector
- GenScript Custom Purified and Recombinant Proteins Services for ITM2B
- GenScript Custom Assay Services for ITM2B
- GenScript Custom overexpressing Cell Line Services for ITM2B
- GenScript: Design CRISPR guide RNA sequences for ITM2B
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for ITM2B
- Sino Biological Human cDNA Clone for ITM2B
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for ITM2B
- Novus Biologicals proteins and lysates for ITM2B
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for ITM2B
- Abcam proteins for ITM2B
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for ITM2B (AFLGC-ITM2B)
- Cyagen custom Knockout/knockin (KOKI) mouse models for ITM2B
- antibodies-online: Search results for 63 available ITM2B Antibodies ranked by validation data
- Compare Top ITM2B Antibodies
- antibodies-online: Search results for 1 available ITM2B Elisa Kits ranked by validation data
- Compare Top ITM2B Elisa Kits
- Quality Products:
- antibodies-online: Search results for 19 available ITM2B Proteins ranked by validation data
- Compare Top ITM2B Proteins
- GeneTex ITM2B Antibody for ITM2B
- Search GeneTex for Proteins for ITM2B
- Santa Cruz Biotechnology (SCBT) Antibodies for ITM2B
- Search Santa Cruz Biotechnology (SCBT) for ITM2B siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for ITM2B
- Search for ITM2B Antibodies at ProSci
- Custom Antibody Services
- ProSci Proteins for ITM2B
- Horizon Cell Lines for ITM2B
- genomics-online: cdna clones - Search results for available ITM2B gene related products
- orf clones - Search results for available ITM2B gene related products
- genomics-online: gRNA clones - Search results for available ITM2B gene related products
- genomics-online: primer clones - Search results for available ITM2B gene related products
- genomics-online: shRNA clones - Search results for available ITM2B gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for ITM2B
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for ITM2B
- GeneCopoeia miRNA 3'UTR Target clone products for ITM2B
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ITM2B
Sources for ITM2B Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio
- (169) Biorbyt