Free for academic non-profit institutions. Other users need a Commercial license
Amyloid precursor proteins are processed by beta-secretase and gamma-secretase to produce beta-amyloid peptides which form the characteristic plaques of Alzheimer disease. This gene encodes a transmembrane protein which is processed at the C-terminus by furin or furin-like proteases to produce a small secreted peptide which inhibits the deposition of beta-amyloid. Mutations which result in extension of the C-terminal end of the encoded protein, thereby increasing the size of the secreted peptide, are associated with two neurogenerative diseases, familial British dementia and familial Danish dementia. [provided by RefSeq, Oct 2009]
ITM2B (Integral Membrane Protein 2B) is a Protein Coding gene. Diseases associated with ITM2B include Retinal Dystrophy With Inner Retinal Dysfunction And Ganglion Cell Abnormalities and Cerebral Amyloid Angiopathy, Itm2b-Related, 1. Among its related pathways are Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 and Metabolism of proteins. Gene Ontology (GO) annotations related to this gene include amyloid-beta binding. An important paralog of this gene is ITM2C.
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0001540 | amyloid-beta binding | IPI | 19849849 |
GO:0005515 | protein binding | IPI | 16027166 |
GO:0005524 | ATP binding | IEA | -- |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000139 | Golgi membrane | IEA | -- |
GO:0005576 | extracellular region | TAS | -- |
GO:0005615 | extracellular space | IDA | 18524908 |
GO:0005768 | endosome | IEA | -- |
GO:0005794 | Golgi apparatus | IBA,IDA | -- |
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 | ||
2 | Metabolism of proteins |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0007399 | nervous system development | TAS | 10391242 |
GO:0042985 | negative regulation of amyloid precursor protein biosynthetic process | IDA | 16027166 |
GO:0044267 | cellular protein metabolic process | TAS | -- |
Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
---|
ExUns: | 1a | · | 1b | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6a | · | 6b | ^ | 7 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | - | ||||||||||||||||
SP2: | |||||||||||||||||
SP3: | - | - | - |
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | ITM2B 33 32 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | ITM2B 33 32 |
|
OneToOne | |
cow (Bos Taurus) |
Mammalia | ITM2B 33 32 |
|
OneToOne | |
oppossum (Monodelphis domestica) |
Mammalia | ITM2B 33 |
|
OneToOne | |
rat (Rattus norvegicus) |
Mammalia | Itm2b 32 |
|
||
mouse (Mus musculus) |
Mammalia | Itm2b 17 33 32 |
|
||
platypus (Ornithorhynchus anatinus) |
Mammalia | ITM2B 33 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | ITM2B 33 32 |
|
OneToOne | |
lizard (Anolis carolinensis) |
Reptilia | ITM2B 33 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | itm2b 32 |
|
||
MGC76131 32 |
|
||||
African clawed frog (Xenopus laevis) |
Amphibia | itm2b-prov 32 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | itm2ba 33 32 |
|
OneToMany | |
itm2bb 33 |
|
OneToMany | |||
wufc05f02 32 |
|
||||
rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.10389 32 |
|
||
fruit fly (Drosophila melanogaster) |
Insecta | CG3662 33 |
|
OneToMany | |
worm (Caenorhabditis elegans) |
Secernentea | C25F6.7 33 |
|
OneToMany |
SNP ID | Clin | Chr 13 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs104894417 | pathogenic, Dementia familial British | 48,261,222(+) | T/A | stop_lost, terminator_codon_variant | |
rs606231166 | pathogenic, Dementia, familial Danish | 48,261,209(+) | TTTAATTTGTT/TTTAATTTGTTTTAATTTGTT | coding_sequence_variant, frameshift | |
rs606231283 | pathogenic, Retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities, Retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities (RDGCA) [MIM:616079] | 48,261,205(+) | A/C | coding_sequence_variant, missense_variant | |
rs1000166839 | -- | 48,252,081(+) | T/C | intron_variant | |
rs1000205858 | -- | 48,235,251(+) | C/T | intron_variant |
Disorder | Aliases | PubMed IDs |
---|---|---|
retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities |
|
|
cerebral amyloid angiopathy, itm2b-related, 1 |
|
|
cerebral amyloid angiopathy, itm2b-related, 2 |
|
|
dementia |
|
|
cerebral amyloid angiopathy, cst3-related |
|