Free for academic non-profit institutions. Other users need a Commercial license

ITM2B Gene(Protein Coding)

Integral Membrane Protein 2B

GCID:
GC13P048233
GIFtS:
53
Genes Participants
UDN Logo

Aliases for ITM2B Gene

Aliases for ITM2B Gene

  • Integral Membrane Protein 2B 2 3 5
  • BRICHOS Domain Containing 2B 2 3
  • Transmembrane Protein BRI 3 4
  • Immature BRI2 3 4
  • ImBRI2 3 4
  • BRI2 3 4
  • BRI 3 4
  • ABri/ADan Amyloid Peptide 3
  • Protein E25B 4
  • BRICD2B 3
  • E3-16 3
  • RDGCA 3
  • ABRI 3
  • E25B 3
  • FBD 3

External Ids for ITM2B Gene

Previous GeneCards Identifiers for ITM2B Gene

  • GC13P046807
  • GC13P042794
  • GC13P047743
  • GC13P046605
  • GC13P046602
  • GC13P047705
  • GC13P048807
  • GC13P029600

Summaries for ITM2B Gene

Entrez Gene Summary for ITM2B Gene

  • Amyloid precursor proteins are processed by beta-secretase and gamma-secretase to produce beta-amyloid peptides which form the characteristic plaques of Alzheimer disease. This gene encodes a transmembrane protein which is processed at the C-terminus by furin or furin-like proteases to produce a small secreted peptide which inhibits the deposition of beta-amyloid. Mutations which result in extension of the C-terminal end of the encoded protein, thereby increasing the size of the secreted peptide, are associated with two neurogenerative diseases, familial British dementia and familial Danish dementia. [provided by RefSeq, Oct 2009]

GeneCards Summary for ITM2B Gene

ITM2B (Integral Membrane Protein 2B) is a Protein Coding gene. Diseases associated with ITM2B include Retinal Dystrophy With Inner Retinal Dysfunction And Ganglion Cell Abnormalities and Cerebral Amyloid Angiopathy, Itm2b-Related, 2. Among its related pathways are Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 and Metabolism of proteins. Gene Ontology (GO) annotations related to this gene include amyloid-beta binding. An important paralog of this gene is ITM2C.

UniProtKB/Swiss-Prot for ITM2B Gene

  • Plays a regulatory role in the processing of the amyloid-beta A4 precursor protein (APP) and acts as an inhibitor of the amyloid-beta peptide aggregation and fibrils deposition. Plays a role in the induction of neurite outgrowth. Functions as a protease inhibitor by blocking access of secretases to APP cleavage sites.

  • Mature BRI2 (mBRI2) functions as a modulator of the amyloid-beta A4 precursor protein (APP) processing leading to a strong reduction in the secretion of secretase-processed amyloid-beta protein 40 and amyloid-beta protein 42.

  • Bri23 peptide prevents aggregation of APP amyloid-beta protein 42 into toxic oligomers.

Gene Wiki entry for ITM2B Gene

Additional gene information for ITM2B Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ITM2B Gene

Genomics for ITM2B Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for ITM2B Gene

Promoters and enhancers for ITM2B Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH13I048230 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 550.8 +1.4 1355 7.7 ATF1 FOXA2 SIN3A FEZF1 IRF4 ZNF48 YY1 ZNF207 ZNF143 ATF7 ITM2B MED4 LPAR6 RB1 LINC00441
GH13I048154 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 39.7 -74.3 -74263 8.7 PKNOX1 ZFP64 ZBTB40 TCF12 ZNF766 FOS ZBTB11 CEBPB REST ZNF592 ITM2B RCBTB2 RB1 LPAR6 MED4 LOC105370198 POLR2KP2
GH13I048143 Enhancer 1.2 FANTOM5 Ensembl ENCODE dbSUPER 25.3 -88.5 -88493 1.5 ATF1 MAX RAD21 ATF2 NR2F2 POLR2A CREB1 ATF7 MYC ITM2B MED4-AS1 SUCLA2 RCBTB2 RB1 MED4 POLR2KP2 LOC105370198
GH13I048184 Enhancer 1.2 FANTOM5 Ensembl ENCODE 12.9 -46.9 -46907 4.2 ZFP64 ZNF266 MAX BMI1 BATF ZNF697 IKZF2 RUNX3 NR2F1 HLF PPP1R26P1 MED4 ITM2B LOC105370198
GH13I048123 Enhancer 1.1 Ensembl ENCODE 13 -107.2 -107245 4.1 ELF3 SMAD1 NFIB ZFP64 INSM2 ZNF2 RAD21 ZSCAN5C ZNF143 MIXL1 MED4 ITM2B MED4-AS1 SUCLA2 POLR2KP2 LOC105370198
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ITM2B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ITM2B gene promoter:

Genomic Locations for ITM2B Gene

Genomic Locations for ITM2B Gene
chr13:48,233,138-48,270,357
(GRCh38/hg38)
Size:
37,220 bases
Orientation:
Plus strand
chr13:48,807,274-48,837,063
(GRCh37/hg19)

Genomic View for ITM2B Gene

Genes around ITM2B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ITM2B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ITM2B Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for ITM2B Gene

Proteins for ITM2B Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for ITM2B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9Y287-ITM2B_HUMAN
    Recommended name:
    Integral membrane protein 2B
    Protein Accession:
    Q9Y287
    Secondary Accessions:
    • Q5W0A3
    • Q96B24
    • Q9NYH1

    Protein attributes for ITM2B Gene

    Size:
    266 amino acids
    Molecular mass:
    30338 Da
    Quaternary structure:
    • Homodimer; disulfide-linked. Interacts with SPPL2A and SPPL2B. Interacts with APP. Mature BRI2 (mBRI2) interacts with the APP amyloid-beta A4 protein; the interaction occurs at the cell surface and in the endocytic compartments and enable alpha- and beta-secretase-induced APP cleavage inhibition. Mature BRI2 (mBRI2) interacts with the APP C99; the interaction occurs in the endocytic compartments and enable gamma-secretase-induced C99 cleavage inhibition. May form heterodimers with Bri23 peptide and APP amyloid-beta protein 40.

    Alternative splice isoforms for ITM2B Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ITM2B Gene

Protein Expression for ITM2B Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for ITM2B Gene

  • Glycosylation at Asn-170 is important for cell surface localization, but doesnt affect furin- and ADAM10-induced proteolytic processing.
  • The ectodomain C-terminal part of the imBRI2 is processed by furin producing a secreted Bri23 peptide and a mature BRI2, membrane form (mBRI2). The remaining part of the ectodomain of mBRI2 containing the BRICHOS domain is cleaved by ADAM10 and is secreted (BRI2C, soluble form). The membrane-bound N-terminal fragment (BRI2C, membrane form) is further proteolytically processed by SPPL2A and SPPL2B through regulated intramembrane proteolysis producing a secreted C-peptide and a BRI2 intracellular domain (BRI2 ICD) released in the cytosol. Shedding by ADAM10 facilitates intramembrane cleavage but is not absolutely required for BRI2 ICD generation.
  • Ubiquitination at isoforms=23 and isoforms=213
  • Glycosylation at isoforms=170

Other Protein References for ITM2B Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for ITM2B Gene

Domains & Families for ITM2B Gene

Gene Families for ITM2B Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted membrane proteins

Protein Domains for ITM2B Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for ITM2B Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9Y287

UniProtKB/Swiss-Prot:

ITM2B_HUMAN :
  • Belongs to the ITM2 family.
Family:
  • Belongs to the ITM2 family.
genes like me logo Genes that share domains with ITM2B: view

Function for ITM2B Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for ITM2B Gene

GENATLAS Biochemistry:
integral membrane protein type 2B,ubiquitously expressed
UniProtKB/Swiss-Prot Function:
Plays a regulatory role in the processing of the amyloid-beta A4 precursor protein (APP) and acts as an inhibitor of the amyloid-beta peptide aggregation and fibrils deposition. Plays a role in the induction of neurite outgrowth. Functions as a protease inhibitor by blocking access of secretases to APP cleavage sites.
UniProtKB/Swiss-Prot Function:
Mature BRI2 (mBRI2) functions as a modulator of the amyloid-beta A4 precursor protein (APP) processing leading to a strong reduction in the secretion of secretase-processed amyloid-beta protein 40 and amyloid-beta protein 42.
UniProtKB/Swiss-Prot Function:
Bri23 peptide prevents aggregation of APP amyloid-beta protein 42 into toxic oligomers.

Gene Ontology (GO) - Molecular Function for ITM2B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001540 amyloid-beta binding IPI 19849849
GO:0005515 protein binding IPI 16027166
GO:0005524 ATP binding IEA --
genes like me logo Genes that share ontologies with ITM2B: view
genes like me logo Genes that share phenotypes with ITM2B: view

Human Phenotype Ontology for ITM2B Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for ITM2B Gene

MGI Knock Outs for ITM2B:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Transcription Factor Targets and HOMER Transcription for ITM2B Gene

Localization for ITM2B Gene

Subcellular locations from UniProtKB/Swiss-Prot for ITM2B Gene

Integral membrane protein 2B: Golgi apparatus membrane; Single-pass type II membrane protein. Note=Immature BRI2 (imBRI2) is cleaved by furin in the Golgi into mBRI2 and a Bri23 peptide. mBRI2 is transported to the plasma membrane and Bri23 peptide is secreted.
BRI2, membrane form: Cell membrane; Single-pass type II membrane protein. Endosome membrane; Single-pass type II membrane protein. Note=Mature BRI2 (mBRI2) needs to be transported from the endoplasmic reticulum compartment to the cell membrane in order to be able to inhibit APP processing. {ECO:0000269 PubMed:19748705}.
Bri23 peptide: Secreted. Note=Detected in the cerebral spinal fluid (CSF). {ECO:0000269 PubMed:18524908}.
BRI2C, soluble form: Secreted.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ITM2B gene
Compartment Confidence
plasma membrane 5
extracellular 5
golgi apparatus 5
endosome 3

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (4)
  • Vesicles (4)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ITM2B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane IEA --
GO:0005576 extracellular region TAS --
GO:0005615 extracellular space IDA 18524908
GO:0005768 endosome IEA --
GO:0005794 Golgi apparatus IDA,IEA --
genes like me logo Genes that share ontologies with ITM2B: view

Pathways & Interactions for ITM2B Gene

genes like me logo Genes that share pathways with ITM2B: view

Pathways by source for ITM2B Gene

2 Reactome pathways for ITM2B Gene

Gene Ontology (GO) - Biological Process for ITM2B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007399 nervous system development TAS 10391242
GO:0042985 negative regulation of amyloid precursor protein biosynthetic process IDA 16027166
GO:0044267 cellular protein metabolic process TAS --
genes like me logo Genes that share ontologies with ITM2B: view

No data available for SIGNOR curated interactions for ITM2B Gene

Drugs & Compounds for ITM2B Gene

Products:

  1. Drug

(1) Additional Compounds for ITM2B Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with ITM2B: view

Transcripts for ITM2B Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for ITM2B Gene

(1) REFSEQ mRNAs :
(13) Additional mRNA sequences :
(1389) Selected AceView cDNA sequences:
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for ITM2B Gene

Integral membrane protein 2B:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for ITM2B Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7
SP1: -
SP2:
SP3: - - -

Relevant External Links for ITM2B Gene

GeneLoc Exon Structure for
ITM2B
ECgene alternative splicing isoforms for
ITM2B

Expression for ITM2B Gene

Products:

  1. Primer

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ITM2B Gene

mRNA expression in normal human tissues for ITM2B Gene
mRNA expression by GTEx for ITM2B GenemRNA expression by BioGPS for ITM2B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for ITM2B Gene

This gene is overexpressed in Whole Blood (x6.7).

Protein differential expression in normal tissues from HIPED for ITM2B Gene

This gene is overexpressed in Amniocyte (31.2) and Urine (30.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for ITM2B Gene



NURSA nuclear receptor signaling pathways regulating expression of ITM2B Gene:

ITM2B

SOURCE GeneReport for Unigene cluster for ITM2B Gene:

Hs.643683

mRNA Expression by UniProt/SwissProt for ITM2B Gene:

Q9Y287-ITM2B_HUMAN
Tissue specificity: Ubiquitous. Expressed in brain.

Evidence on tissue expression from TISSUES for ITM2B Gene

  • Nervous system(5)
  • Adrenal gland(4.6)
  • Lung(4.3)
  • Kidney(4.2)
  • Liver(4.2)
  • Intestine(3.6)
  • Pancreas(3.6)
  • Eye(3.4)
  • Blood(3)
  • Stomach(2.8)
  • Spleen(2.7)
  • Heart(2.6)
  • Gall bladder(2.5)
  • Thyroid gland(2.5)
  • Muscle(2.4)
  • Skin(2.4)
  • Lymph node(2.3)
  • Bone marrow(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ITM2B Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • nervous
  • skeletal muscle
Regions:
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • ear
  • eye
  • head
General:
  • blood vessel
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with ITM2B: view

Primer Products

No data available for Protein tissue co-expression partners for ITM2B Gene

Orthologs for ITM2B Gene

This gene was present in the common ancestor of animals.

Orthologs for ITM2B Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia ITM2B 33 34
  • 99.87 (n)
dog
(Canis familiaris)
 Mammalia ITM2B 33 34
  • 91.71 (n)
cow
(Bos Taurus)
 Mammalia ITM2B 33 34
  • 90.57 (n)
oppossum
(Monodelphis domestica)
 Mammalia ITM2B 34
  • 89 (a)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Itm2b 33
  • 88.22 (n)
mouse
(Mus musculus)
 Mammalia Itm2b 33 16 34
  • 86.09 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia ITM2B 34
  • 83 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves ITM2B 33 34
  • 74.74 (n)
lizard
(Anolis carolinensis)
 Reptilia ITM2B 34
  • 77 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia itm2b 33
  • 72.53 (n)
MGC76131 33
African clawed frog
(Xenopus laevis)
 Amphibia itm2b-prov 33
zebrafish
(Danio rerio)
 Actinopterygii itm2ba 33 34
  • 64.71 (n)
itm2bb 34
  • 59 (a)
 OneToMany
wufc05f02 33
rainbow trout
(Oncorhynchus mykiss)
 Actinopterygii Omy.10389 33
fruit fly
(Drosophila melanogaster)
 Insecta CG3662 34
  • 18 (a)
 OneToMany
worm
(Caenorhabditis elegans)
 Secernentea C25F6.7 34
  • 20 (a)
 OneToMany
Species where no ortholog for ITM2B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ITM2B Gene

ENSEMBL:
Gene Tree for ITM2B (if available)
TreeFam:
Gene Tree for ITM2B (if available)

Paralogs for ITM2B Gene

Paralogs for ITM2B Gene

(8) SIMAP similar genes for ITM2B Gene using alignment to 6 proteins:

Pseudogenes.org Pseudogenes for ITM2B Gene

genes like me logo Genes that share paralogs with ITM2B: view

Variants for ITM2B Gene

Sequence variations from dbSNP and Humsavar for ITM2B Gene

SNP ID Clin Chr 13 pos Variation AA Info Type
rs104894417 pathogenic, Dementia familial British 48,261,222(+) T/A stop_lost, terminator_codon_variant
rs606231166 pathogenic, Dementia, familial Danish 48,261,209(+) TTTAATTTGTT/TTTAATTTGTTTTAATTTGTT coding_sequence_variant, frameshift
rs606231283 pathogenic, Retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities, Retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities (RDGCA) [MIM:616079] 48,261,205(+) A/C coding_sequence_variant, missense_variant
rs1000166839 -- 48,252,081(+) T/C intron_variant
rs1000205858 -- 48,235,251(+) C/T intron_variant

Variation tolerance for ITM2B Gene

Residual Variation Intolerance Score: 42.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.82; 47.80% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ITM2B Gene

Human Gene Mutation Database (HGMD)
ITM2B
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ITM2B

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for ITM2B Gene

Disorders for ITM2B Gene

MalaCards: The human disease database

(12) MalaCards diseases for ITM2B Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search ITM2B in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

ITM2B_HUMAN
  • Cerebral amyloid angiopathy, ITM2B-related 1 (CAA-ITM2B1) [MIM:176500]: A disorder characterized by amyloid deposition in the walls of cerebral blood vessels and neurodegeneration in the central nervous system. Cerebral amyloid angiopathy, non-neuritic and perivascular plaques and neurofibrillary tangles are the predominant pathological lesions. Clinical features include progressive mental deterioration, spasticity and muscular rigidity. {ECO:0000269 PubMed:10391242, ECO:0000269 PubMed:10526337, ECO:0000269 PubMed:14656991}. Note=The disease is caused by mutations affecting the gene represented in this entry. A single base substitution at the stop codon of ITM2B generates a 277-residue precursor that is cleaved at the normal furin processing site to generate the ABri amyloidogenic peptide (PubMed:10391242). ABri accumulates in the brain and produces amyloid fibrils responsible for neuronal dysfunction and dementia. ABri peptide variant forms fibrils in vitro (PubMed:10526337). {ECO:0000269 PubMed:10391242, ECO:0000269 PubMed:10526337}.
  • Cerebral amyloid angiopathy, ITM2B-related 2 (CAA-ITM2B2) [MIM:117300]: A disorder characterized by amyloid deposition in the walls of the blood vessels of the cerebrum, choroid plexus, cerebellum, spinal cord and retina. Plaques and neurofibrillary tangles are observed in the hippocampus. Clinical features include progressive ataxia, dementia, cataracts and deafness. {ECO:0000269 PubMed:10781099, ECO:0000269 PubMed:14656991, ECO:0000269 PubMed:16091362}. Note=The disease is caused by mutations affecting the gene represented in this entry. A decamer duplication in the 3 region of ITM2B results in the production of the ADan amyloidogenic peptide (PubMed:10781099). ADan is generated by cleavage of the mutated precursor at the normal furin processing site. ADan accumulates in the brain and produces amyloid fibrils responsible for neuronal dysfunction and dementia. {ECO:0000269 PubMed:10781099}.
  • Retinal dystrophy with inner retinal dysfunction and ganglion cell abnormalities (RDGCA) [MIM:616079]: An autosomal dominant retinal dystrophy characterized by inner retinal dysfunction in association with ganglion cell abnormalities. Clinical features include mild photophobia, progressive loss of central vision, night blindness, and hyperreflectivity of nerve and ganglion cell layers. {ECO:0000269 PubMed:24026677}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for ITM2B

ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ITM2B: view

No data available for Genatlas for ITM2B Gene

Publications for ITM2B Gene

  1. BRI2 homodimerizes with the involvement of intermolecular disulfide bonds. (PMID: 18440095) Tsachaki M … Efthimiopoulos S (Neurobiology of aging 2010) 3 4 22 58
  2. Regulated intramembrane proteolysis of Bri2 (Itm2b) by ADAM10 and SPPL2a/SPPL2b. (PMID: 17965014) Martin L … Haass C (The Journal of biological chemistry 2008) 3 4 22 58
  3. BRI2 interacts with amyloid precursor protein (APP) and regulates amyloid beta (Abeta) production. (PMID: 16027166) Fotinopoulou A … Efthimiopoulos S (The Journal of biological chemistry 2005) 3 4 22 58
  4. The familial dementia BRI2 gene binds the Alzheimer gene amyloid-beta precursor protein and inhibits amyloid-beta production. (PMID: 15983050) Matsuda S … D'Adamio L (The Journal of biological chemistry 2005) 3 4 22 58
  5. Axonal transport of British and Danish amyloid peptides via secretory vesicles. (PMID: 14656991) Choi SI … Levy E (FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2004) 3 4 22 58

Products for ITM2B Gene

Sources for ITM2B Gene

Content
Loading form....