Free for academic non-profit institutions. Other users need a Commercial license
This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2019]
INS (Insulin) is a Protein Coding gene. Diseases associated with INS include Hyperproinsulinemia and Diabetes Mellitus, Insulin-Dependent, 2. Among its related pathways are Vesicle-mediated transport and PI3K/AKT activation. Gene Ontology (GO) annotations related to this gene include identical protein binding and protease binding. An important paralog of this gene is INS-IGF2.
GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
---|---|---|---|---|---|---|---|---|---|---|
GH11J002161 | Promoter/Enhancer | 0.6 | EPDnew dbSUPER | 750.6 | +0.1 | 112 | 0.1 | GLIS1 | INS INS-IGF2 NONHSAG007414.2 | |
GH11J002026 | Enhancer | 0.5 | Ensembl ENCODE | 11.4 | +131.7 | 131730 | 6.4 | SCRT2 PRDM4 | ENSG00000240801 MIR483 TH IGF2-AS IGF2 INS INS-IGF2 KRTAP5-5 HSALNG0082184 piR-56684 | |
GH11J002187 | Enhancer | 0.4 | Ensembl dbSUPER | 11.6 | -24.9 | -24860 | 0.4 | CTCF | INS INS-IGF2 IGF2 CD81 ENSG00000199550 HSALNG0082199 piR-50444-054 | |
GH11J002443 | Promoter/Enhancer | 1.7 | EPDnew FANTOM5 Ensembl ENCODE dbSUPER | 1.3 | -284.9 | -284945 | 4.6 | CTCF GLIS2 ZIC2 PATZ1 SP2 ZFX POLR2A EZH2 ZNF423 ZFHX2 | KCNQ1 HSALNG0082233 NONHSAG007430.2 C11orf21 TSPAN32 TRPM5 TSSC4 INS piR-48369-028 | |
GH11J002185 | Enhancer | 0.2 | Ensembl | 11.6 | -24.0 | -23960 | 0.2 | INS INS-IGF2 IGF2 ENSG00000199550 CD81 HSALNG0082199 piR-50444-054 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0002020 | protease binding | IPI | 20082125 |
GO:0005158 | insulin receptor binding | IPI | 8452530 |
GO:0005159 | insulin-like growth factor receptor binding | IPI,ISS | 8452530 |
GO:0005179 | hormone activity | NAS,IEA | 14986111 |
GO:0005515 | protein binding | IPI | 9388210 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000139 | Golgi membrane | TAS | -- |
GO:0005576 | extracellular region | TAS,IEA | -- |
GO:0005615 | extracellular space | IDA,ISS | 9667398 |
GO:0005788 | endoplasmic reticulum lumen | TAS | -- |
GO:0005796 | Golgi lumen | TAS | -- |
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | RET signaling |
.92
|
|
2 | Regulation of lipid metabolism Insulin signaling-generic cascades |
.01
|
|
3 | PI3K/AKT activation |
.89
|
|
4 | Transport to the Golgi and subsequent modification | ||
5 | Regulation of beta-cell development |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0002674 | negative regulation of acute inflammatory response | IDA | 11443198 |
GO:0005975 | carbohydrate metabolic process | IEA | -- |
GO:0006006 | glucose metabolic process | IEA | -- |
GO:0006355 | regulation of transcription, DNA-templated | NAS | 12881524 |
GO:0006521 | regulation of cellular amino acid metabolic process | IMP | 3553851 |
Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
---|---|---|---|---|---|---|
Zinc | Approved, Investigational | Pharma | Target | 2741 | ||
zinc acetate | Approved, Investigational | Pharma | Target | 0 | ||
Zinc chloride | Approved, Investigational | Pharma | Target | 0 | ||
m-Cresol | Experimental | Pharma | Target | 0 | ||
Myristic acid | Experimental | Pharma | Target | 0 |
Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
---|
Compound | Action | Cas Number |
---|---|---|
MSDC-0160 | mTOT-modulating insulin sensitizer | 146062-49-9 |
This gene was present in the common ancestor of chordates.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | INS 33 32 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | INS 32 |
|
||
cow (Bos Taurus) |
Mammalia | INS 33 |
|
OneToOne | |
mouse (Mus musculus) |
Mammalia | Ins2 17 33 32 |
|
||
Ins1 33 |
|
OneToMany | |||
rat (Rattus norvegicus) |
Mammalia | Ins2 32 |
|
||
chicken (Gallus gallus) |
Aves | INS 33 32 |
|
OneToMany | |
lizard (Anolis carolinensis) |
Reptilia | -- 33 |
|
OneToMany | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | ins 32 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | ins 33 32 32 |
|
ManyToMany | |
insb 33 |
|
ManyToMany |
SNP ID | Clin | Chr 11 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs1057524907 | likely-pathogenic, Monogenic diabetes | 2,159,907(-) | T/C | coding_sequence_variant, missense_variant | |
rs1135401727 | pathogenic, Permanent neonatal diabetes mellitus | 2,161,314(-) | AGATGGCTGGGGGCTGAGGCTGCAA/A | upstream_transcript_variant | |
rs121908259 | not-provided, Maturity-onset diabetes of the young, type 10, Maturity-onset diabetes of the young 10 (MODY10) [MIM:613370] | 2,160,955(-) | C/T | coding_sequence_variant, missense_variant | |
rs121908260 | pathogenic, Maturity-onset diabetes of the young, type 10, Maturity-onset diabetes of the young 10 (MODY10) [MIM:613370] | 2,160,835(-) | C/T | coding_sequence_variant, missense_variant | |
rs121908261 | pathogenic, Diabetes mellitus, insulin-dependent, 2, Diabetes mellitus, insulin-dependent, 2 (IDDM2) [MIM:125852] | 2,160,809(-) | G/A | coding_sequence_variant, missense_variant |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
dgv1566n54 | CNV | loss | 21841781 |
dgv1567n54 | CNV | loss | 21841781 |
nsv467645 | CNV | gain | 19166990 |
nsv553047 | CNV | gain | 21841781 |
nsv553068 | CNV | loss | 21841781 |
nsv553069 | CNV | loss | 21841781 |
nsv553070 | CNV | loss | 21841781 |
nsv553076 | CNV | loss | 21841781 |
nsv553077 | CNV | loss | 21841781 |
nsv553078 | CNV | loss | 21841781 |
nsv951284 | CNV | deletion | 24416366 |
Disorder | Aliases | PubMed IDs |
---|---|---|
hyperproinsulinemia |
|
|
diabetes mellitus, insulin-dependent, 2 |
|
|
maturity-onset diabetes of the young, type 10 |
|
|
diabetes mellitus, permanent neonatal |
|
|
neonatal diabetes mellitus |
|