INS Gene (Protein Coding)

Insulin

GC11M002159
GIFtS:
49
This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the ... See more...

Aliases for INS Gene

Aliases for INS Gene

  • Insulin 2 3 4 5
  • Insulin-Dependent Diabetes Mellitus 2 2
  • Preproinsulin 3
  • Proinsulin 3
  • MODY10 3
  • IDDM1 3
  • IDDM2 3
  • IDDM 3
  • ILPR 3
  • IRDN 3

External Ids for INS Gene

Previous HGNC Symbols for INS Gene

  • IDDM2
  • IDDM1

Previous GeneCards Identifiers for INS Gene

  • GC11U990070
  • GC11M002268
  • GC11M002140
  • GC11M002145
  • GC11M002137
  • GC11M002106
  • GC11M002125
  • GC11M002153
  • GC11M001971
  • GC11M002181

Summaries for INS Gene

Entrez Gene Summary for INS Gene

  • This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2019]

GeneCards Summary for INS Gene

INS (Insulin) is a Protein Coding gene. Diseases associated with INS include Hyperproinsulinemia and Diabetes Mellitus, Insulin-Dependent, 2. Among its related pathways are Vesicle-mediated transport and PI3K/AKT activation. Gene Ontology (GO) annotations related to this gene include identical protein binding and protease binding. An important paralog of this gene is INS-IGF2.

UniProtKB/Swiss-Prot Summary for INS Gene

  • Insulin decreases blood glucose concentration. It increases cell permeability to monosaccharides, amino acids and fatty acids. It accelerates glycolysis, the pentose phosphate cycle, and glycogen synthesis in liver.

Gene Wiki entry for INS Gene

Additional gene information for INS Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for INS Gene

Genomics for INS Gene

GeneHancer (GH) Regulatory Elements for INS Gene

Promoters and enhancers for INS Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH11J002161 Promoter/Enhancer 0.6 EPDnew dbSUPER 750.6 +0.1 112 0.1 GLIS1 INS INS-IGF2 NONHSAG007414.2
GH11J002026 Enhancer 0.5 Ensembl ENCODE 11.4 +131.7 131730 6.4 SCRT2 PRDM4 ENSG00000240801 MIR483 TH IGF2-AS IGF2 INS INS-IGF2 KRTAP5-5 HSALNG0082184 piR-56684
GH11J002187 Enhancer 0.4 Ensembl dbSUPER 11.6 -24.9 -24860 0.4 CTCF INS INS-IGF2 IGF2 CD81 ENSG00000199550 HSALNG0082199 piR-50444-054
GH11J002443 Promoter/Enhancer 1.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 1.3 -284.9 -284945 4.6 CTCF GLIS2 ZIC2 PATZ1 SP2 ZFX POLR2A EZH2 ZNF423 ZFHX2 KCNQ1 HSALNG0082233 NONHSAG007430.2 C11orf21 TSPAN32 TRPM5 TSSC4 INS piR-48369-028
GH11J002185 Enhancer 0.2 Ensembl 11.6 -24.0 -23960 0.2 INS INS-IGF2 IGF2 ENSG00000199550 CD81 HSALNG0082199 piR-50444-054
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around INS on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the INS gene promoter:
  • AP-1
  • CREB
  • deltaCREB
  • GR
  • GR-alpha

Genomic Locations for INS Gene

Genomic Locations for INS Gene
chr11:2,159,779-2,161,341
(GRCh38/hg38)
Size:
1,563 bases
Orientation:
Minus strand
chr11:2,181,009-2,182,571
(GRCh37/hg19)
Size:
1,563 bases
Orientation:
Minus strand

Genomic View for INS Gene

Genes around INS on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
INS Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for INS Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for INS Gene

Proteins for INS Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for INS Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P01308-INS_HUMAN
    Recommended name:
    Insulin
    Protein Accession:
    P01308
    Secondary Accessions:
    • Q5EEX2

    Protein attributes for INS Gene

    Size:
    110 amino acids
    Molecular mass:
    11981 Da
    Quaternary structure:
    • Heterodimer of a B chain and an A chain linked by two disulfide bonds (PubMed:25423173).
    SequenceCaution:
    • Sequence=AAA59179.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for INS Gene

    Alternative splice isoforms for INS Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for INS Gene

Protein Expression for INS Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for INS Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for INS Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

Assay Products

No data available for DME Specific Peptides for INS Gene

Domains & Families for INS Gene

Gene Families for INS Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Candidate cardiovascular disease genes
  • Disease related genes
  • Plasma proteins
  • Predicted secreted proteins

Protein Domains for INS Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for INS Gene

GenScript: Design optimal peptide antigens:
  • Insulin (F6MZK5_HUMAN)
  • Insulin (INS_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P01308

UniProtKB/Swiss-Prot:

INS_HUMAN :
  • Belongs to the insulin family.
Family:
  • Belongs to the insulin family.
genes like me logo Genes that share domains with INS: view

Function for INS Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for INS Gene

UniProtKB/Swiss-Prot Function:
Insulin decreases blood glucose concentration. It increases cell permeability to monosaccharides, amino acids and fatty acids. It accelerates glycolysis, the pentose phosphate cycle, and glycogen synthesis in liver.
GENATLAS Biochemistry:
insulin

LifeMap Function Summary for INS Gene

INS as growth factor is involved in stem cell differentiation protocols towards the derivation of the following cells:

Phenotypes From GWAS Catalog for INS Gene

Gene Ontology (GO) - Molecular Function for INS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002020 protease binding IPI 20082125
GO:0005158 insulin receptor binding IPI 8452530
GO:0005159 insulin-like growth factor receptor binding IPI,ISS 8452530
GO:0005179 hormone activity NAS,IEA 14986111
GO:0005515 protein binding IPI 9388210
genes like me logo Genes that share ontologies with INS: view
genes like me logo Genes that share phenotypes with INS: view

Human Phenotype Ontology for INS Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for INS Gene

MGI Knock Outs for INS:

Animal Model Products

CRISPR Products

miRNA for INS Gene

miRTarBase miRNAs that target INS

Clone Products

  • Addgene plasmids for INS

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for INS Gene

Localization for INS Gene

Subcellular locations from UniProtKB/Swiss-Prot for INS Gene

Secreted.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for INS gene
Compartment Confidence
extracellular 5
endoplasmic reticulum 5
plasma membrane 4
endosome 4
cytosol 4
golgi apparatus 4
cytoskeleton 3
mitochondrion 3
peroxisome 3
nucleus 3
lysosome 2

Gene Ontology (GO) - Cellular Components for INS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane TAS --
GO:0005576 extracellular region TAS,IEA --
GO:0005615 extracellular space IDA,ISS 9667398
GO:0005788 endoplasmic reticulum lumen TAS --
GO:0005796 Golgi lumen TAS --
genes like me logo Genes that share ontologies with INS: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for INS Gene

Pathways & Interactions for INS Gene

genes like me logo Genes that share pathways with INS: view

Pathways by source for INS Gene

1 Sino Biological pathway for INS Gene
9 Qiagen pathways for INS Gene
  • AMPK Enzyme Complex Pathway
  • eIF2 Pathway
  • Insulin Receptor Pathway
  • MODY (Maturity-Onset Diabetes of Young)
  • mTOR Pathway
1 Cell Signaling Technology pathway for INS Gene
1 GeneTex pathway for INS Gene

SIGNOR curated interactions for INS Gene

Activates:
Inactivates:
Is activated by:

Gene Ontology (GO) - Biological Process for INS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002674 negative regulation of acute inflammatory response IDA 11443198
GO:0005975 carbohydrate metabolic process IEA --
GO:0006006 glucose metabolic process IEA --
GO:0006355 regulation of transcription, DNA-templated NAS 12881524
GO:0006521 regulation of cellular amino acid metabolic process IMP 3553851
genes like me logo Genes that share ontologies with INS: view

Drugs & Compounds for INS Gene

Products:

  1. Drug

(88) Drugs for INS Gene - From: DrugBank, ApexBio, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Zinc Approved, Investigational Pharma Target 2741
zinc acetate Approved, Investigational Pharma Target 0
Zinc chloride Approved, Investigational Pharma Target 0
m-Cresol Experimental Pharma Target 0
Myristic acid Experimental Pharma Target 0

(46) Additional Compounds for INS Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs

(1) ApexBio Compounds for INS Gene

Compound Action Cas Number
MSDC-0160 mTOT-modulating insulin sensitizer 146062-49-9
genes like me logo Genes that share compounds with INS: view

Transcripts for INS Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for INS Gene

(4) REFSEQ mRNAs :
(10) Additional mRNA sequences :
(90) Selected AceView cDNA sequences:
(5) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

  • Addgene plasmids for INS

Alternative Splicing Database (ASD) splice patterns (SP) for INS Gene

No ASD Table

Relevant External Links for INS Gene

GeneLoc Exon Structure for
INS
ECgene alternative splicing isoforms for
INS

Expression for INS Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for INS Gene

mRNA expression in normal human tissues for INS Gene
mRNA expression by BioGPS for INS GenemRNA expression by GTEx for INS Gene

mRNA differential expression in normal tissues according to GTEx for INS Gene

This gene is overexpressed in Pancreas (x52.8).

Protein differential expression in normal tissues from HIPED for INS Gene

This gene is overexpressed in Islet of Langerhans (36.1) and Ovary (32.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for INS Gene



Protein tissue co-expression partners for INS Gene

NURSA nuclear receptor signaling pathways regulating expression of INS Gene:

INS

Evidence on tissue expression from TISSUES for INS Gene

  • Blood(4.8)
  • Pancreas(4.8)
  • Liver(3.9)
  • Muscle(3.9)
  • Nervous system(3.6)
  • Heart(3.4)
  • Kidney(3.2)
  • Intestine(3.1)
  • Adrenal gland(3)
  • Skin(3)
  • Thyroid gland(3)
  • Urine(3)
  • Stomach(2.7)
  • Bone(2.5)
  • Lung(2.3)
  • Bone marrow(2.2)
  • Spleen(2.2)
  • Eye(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for INS Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • lip
  • nose
  • skull
Thorax:
  • chest wall
  • heart
Abdomen:
  • abdominal wall
  • kidney
  • pancreas
Pelvis:
  • penis
  • placenta
  • uterus
Limb:
  • ankle
  • digit
  • elbow
  • finger
  • foot
  • hand
  • hip
  • knee
  • lower limb
  • shoulder
  • toe
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • peripheral nerve
  • peripheral nervous system
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with INS: view

No data available for mRNA Expression by UniProt/SwissProt for INS Gene

Orthologs for INS Gene

This gene was present in the common ancestor of chordates.

Orthologs for INS Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia INS 33 32
  • 98.18 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia INS 32
  • 86.06 (n)
cow
(Bos Taurus)
 Mammalia INS 33
  • 84 (a)
 OneToOne
mouse
(Mus musculus)
 Mammalia Ins2 17 33 32
  • 82.42 (n)
Ins1 33
  • 80 (a)
 OneToMany
rat
(Rattus norvegicus)
 Mammalia Ins2 32
  • 81.21 (n)
chicken
(Gallus gallus)
 Aves INS 33 32
  • 65.42 (n)
 OneToMany
lizard
(Anolis carolinensis)
 Reptilia -- 33
  • 55 (a)
 OneToMany
tropical clawed frog
(Silurana tropicalis)
 Amphibia ins 32
  • 64.08 (n)
zebrafish
(Danio rerio)
 Actinopterygii ins 33 32 32
  • 61.78 (n)
 ManyToMany
insb 33
  • 31 (a)
 ManyToMany
Species where no ortholog for INS was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for INS Gene

ENSEMBL:
Gene Tree for INS (if available)
TreeFam:
Gene Tree for INS (if available)
Aminode:
Evolutionary constrained regions (ECRs) for INS: view image

Paralogs for INS Gene

Paralogs for INS Gene

(3) SIMAP similar genes for INS Gene using alignment to 5 proteins:

  • INS_HUMAN
  • A6XGL2_HUMAN
  • C9JNR5_HUMAN
  • F6MZK5_HUMAN
  • I3WAC9_HUMAN
genes like me logo Genes that share paralogs with INS: view

Variants for INS Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for INS Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs1057524907 likely-pathogenic, Monogenic diabetes 2,159,907(-) T/C coding_sequence_variant, missense_variant
rs1135401727 pathogenic, Permanent neonatal diabetes mellitus 2,161,314(-) AGATGGCTGGGGGCTGAGGCTGCAA/A upstream_transcript_variant
rs121908259 not-provided, Maturity-onset diabetes of the young, type 10, Maturity-onset diabetes of the young 10 (MODY10) [MIM:613370] 2,160,955(-) C/T coding_sequence_variant, missense_variant
rs121908260 pathogenic, Maturity-onset diabetes of the young, type 10, Maturity-onset diabetes of the young 10 (MODY10) [MIM:613370] 2,160,835(-) C/T coding_sequence_variant, missense_variant
rs121908261 pathogenic, Diabetes mellitus, insulin-dependent, 2, Diabetes mellitus, insulin-dependent, 2 (IDDM2) [MIM:125852] 2,160,809(-) G/A coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for INS Gene

Variant ID Type Subtype PubMed ID
dgv1566n54 CNV loss 21841781
dgv1567n54 CNV loss 21841781
nsv467645 CNV gain 19166990
nsv553047 CNV gain 21841781
nsv553068 CNV loss 21841781
nsv553069 CNV loss 21841781
nsv553070 CNV loss 21841781
nsv553076 CNV loss 21841781
nsv553077 CNV loss 21841781
nsv553078 CNV loss 21841781
nsv951284 CNV deletion 24416366

Variation tolerance for INS Gene

Residual Variation Intolerance Score: 48.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.10; 2.26% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for INS Gene

Human Gene Mutation Database (HGMD)
INS
SNPedia medical, phenotypic, and genealogical associations of SNPs for
INS

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for INS Gene

Disorders for INS Gene

MalaCards: The human disease database

(197) MalaCards diseases for INS Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
hyperproinsulinemia
  • hpri
diabetes mellitus, insulin-dependent, 2
  • insulin-dependent diabetes mellitus 2; iddm2
maturity-onset diabetes of the young, type 10
  • mody10
diabetes mellitus, permanent neonatal
  • pndm
neonatal diabetes mellitus
  • diabetes mellitus syndrome in newborn infant
- elite association - COSMIC cancer census association via MalaCards
Search INS in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

INS_HUMAN
  • Hyperproinsulinemia (HPRI) [MIM:616214]: An autosomal dominant condition characterized by elevated levels of serum proinsulin-like material. {ECO:0000269 PubMed:1601997, ECO:0000269 PubMed:2196279, ECO:0000269 PubMed:3470784, ECO:0000269 PubMed:4019786}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Diabetes mellitus, insulin-dependent, 2 (IDDM2) [MIM:125852]: A multifactorial disorder of glucose homeostasis that is characterized by susceptibility to ketoacidosis in the absence of insulin therapy. Clinical features are polydipsia, polyphagia and polyuria which result from hyperglycemia-induced osmotic diuresis and secondary thirst. These derangements result in long-term complications that affect the eyes, kidneys, nerves, and blood vessels. {ECO:0000269 PubMed:18192540}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Diabetes mellitus, permanent neonatal (PNDM) [MIM:606176]: A rare form of diabetes distinct from childhood-onset autoimmune diabetes mellitus type 1. It is characterized by insulin-requiring hyperglycemia that is diagnosed within the first months of life. Permanent neonatal diabetes requires lifelong therapy. {ECO:0000269 PubMed:17855560, ECO:0000269 PubMed:18162506}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Maturity-onset diabetes of the young 10 (MODY10) [MIM:613370]: A form of diabetes that is characterized by an autosomal dominant mode of inheritance, onset in childhood or early adulthood (usually before 25 years of age), a primary defect in insulin secretion and frequent insulin-independence at the beginning of the disease. {ECO:0000269 PubMed:18162506, ECO:0000269 PubMed:18192540, ECO:0000269 PubMed:20226046, ECO:0000269 PubMed:25423173}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Genatlas disease for INS Gene

diabetes,with hyperproinsulinemia,putative susceptibility factor for obesity in association with IgF2 in British population

Additional Disease Information for INS

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with INS: view

Publications for INS Gene

  1. Insulin mutation screening in 1,044 patients with diabetes: mutations in the INS gene are a common cause of neonatal diabetes but a rare cause of diabetes diagnosed in childhood or adulthood. (PMID: 18162506) Edghill EL … Ellard S (Diabetes 2008) 3 4 43 56
  2. Insulin gene mutations as a cause of permanent neonatal diabetes. (PMID: 17855560) Støy J … Neonatal Diabetes International Collaborative Group (Proceedings of the National Academy of Sciences of the United States of America 2007) 3 4 23 56
  3. Susceptibility to insulin dependent diabetes mellitus maps to a 4.1 kb segment of DNA spanning the insulin gene and associated VNTR. (PMID: 8358440) Lucassen AM … Bell JI (Nature genetics 1993) 3 4 43 56
  4. A mutation in the B chain coding region is associated with impaired proinsulin conversion in a family with hyperproinsulinemia. (PMID: 3470784) Chan SJ … Steiner DF (Proceedings of the National Academy of Sciences of the United States of America 1987) 3 4 43 56
  5. Sequence of the human insulin gene. (PMID: 6243748) Bell GI … Goodman HM (Nature 1980) 2 3 4 56

ExternalLinks

View latest publications for INS gene in Mastermind

Products for INS Gene

  • Addgene plasmids for INS