Aliases for HTT-AS Gene

Subcategory (RNA class) for HTT-AS Gene

lncRNA

Quality Score for this RNA gene is

15

Aliases for HTT-AS Gene

  • HTT Antisense RNA 2 3 5
  • HTT Antisense RNA 1 (Non-Protein Coding) 2 3
  • HTT Antisense RNA (Head To Head) 2 3
  • HTT-AS 2 170
  • HTT Antisense RNA 1 (Head To Head) 3
  • HTT Antisense RNA 1 2
  • HSALNG0032415 169
  • NONHSAG037328 94
  • NONHSAG037324 94
  • HTT-AS1 3
  • HTTAS 3

External Ids for HTT-AS Gene

Previous HGNC Symbols for HTT-AS Gene

  • HTT-AS1

Previous GeneCards Identifiers for HTT-AS Gene

  • GC04M003067

Summaries for HTT-AS Gene

GeneCards Summary for HTT-AS Gene

HTT-AS (HTT Antisense RNA) is an RNA Gene, and is affiliated with the lncRNA class. Diseases associated with HTT-AS include Huntington Disease.

Rfam classification for HTT-AS Gene

  • HTT antisense RNA 1 conserved region 3
  • HTT antisense RNA 1 conserved region 2
  • HTT antisense RNA 1 conserved region 1

Additional gene information for HTT-AS Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary and piRNA Summary for HTT-AS Gene

Genomics for HTT-AS Gene

GeneHancer (GH) Regulatory Elements for HTT-AS Gene

Promoters and enhancers for HTT-AS Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH04J003073 Promoter/Enhancer 2 EPDnew Ensembl ENCODE CraniofacialAtlas 758.5 -1.1 -1135 6.1 SP1 SREBF1 MLX POLR2A HCFC1 MIXL1 NFYC ETV6 ELF1 RELA HTT-AS HTT 5MWI_A-129 RNF4 FAM193A HAUS3 MFSD10 NOP14-AS1 NOP14 MSANTD1
GH04J003039 Promoter/Enhancer 1.4 EPDnew Ensembl ENCODE 27.1 +33.6 33589 3.9 SP1 POLR2A MLLT1 ZNF687 CREM IKZF1 CEBPA RXRA SMAD5 IKZF2 HTT HTT-AS RNU7-33P GRK4 piR-57133-438
GH04J002930 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 10.4 +140.3 140336 8.2 SP1 ZBTB40 CTCF MLX RBPJ POLR2A NR2F1 ATF1 NR2F6 CREB1 NOP14-AS1 MFSD10 FAM193A GRK4 NELFA RNF4 HAUS3 HTT HTT-AS lnc-NOP14-4
GH04J003044 Promoter/Enhancer 1.5 FANTOM5 Ensembl ENCODE 10.6 +27.6 27641 4.4 ZNF24 SP1 CTCF USF2 CC2D1A ETV6 L3MBTL2 MAX RAD21 SREBF1 lnc-GRK4-1 SH3BP2 HTT-AS GRK4 HGFAC RGS12 TNIP2 HTT lnc-HTT-1
GH04J003058 Enhancer 1 FANTOM5 Ensembl ENCODE 12.2 +14.0 14037 5.8 MYC MAX TEAD4 MLLT1 CREM IKZF1 REST IKZF2 HDAC1 RFX1 lnc-HTT-1 lnc-NOP14-5 lnc-NOP14-6 HTT-AS GRK4 HTT SH3BP2 HGFAC RGS12 piR-46371
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around HTT-AS on UCSC Golden Path with GeneCards custom track

Genomic Locations for HTT-AS Gene

Genomic Locations for HTT-AS Gene
chr4:3,048,600-3,074,538
(GRCh38/hg38)
Size:
25,939 bases
Orientation:
Minus strand
chr4:3,065,198-3,076,241
(GRCh37/hg19)
Size:
11,044 bases
Orientation:
Minus strand

Genomic View for HTT-AS Gene

Genes around HTT-AS on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HTT-AS Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HTT-AS Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HTT-AS Gene

Proteins for HTT-AS Gene

Post-translational modifications for HTT-AS Gene

No Post-translational modifications

No data available for DME Specific Peptides for HTT-AS Gene

Domains & Families for HTT-AS Gene

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for HTT-AS Gene

Function for HTT-AS Gene

Phenotypes From GWAS Catalog for HTT-AS Gene

Animal Model Products

CRISPR Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for HTT-AS Gene

Localization for HTT-AS Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for HTT-AS Gene

Pathways & Interactions for HTT-AS Gene

PathCards logo

SuperPathways for HTT-AS Gene

No Data Available

Gene Ontology (GO) - Biological Process for HTT-AS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0010468 regulation of gene expression IEA --
genes like me logo Genes that share ontologies with HTT-AS: view

No data available for Pathways by source and SIGNOR curated interactions for HTT-AS Gene

Drugs & Compounds for HTT-AS Gene

No Compound Related Data Available

Transcripts for HTT-AS Gene

mRNA/cDNA for HTT-AS Gene

(1) REFSEQ mRNAs :
(1) Additional mRNA sequences :
(4) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
(6) RNACentral transcripts :
(3) LncBook transcripts :
(5) LNCipedia transcripts :
(2) NONCODE transcripts :

CRISPR Products

Alternative Splicing Database (ASD) splice patterns (SP) for HTT-AS Gene

No ASD Table

Relevant External Links for HTT-AS Gene

GeneLoc Exon Structure for
HTT-AS
ECgene alternative splicing isoforms for
HTT-AS

Expression for HTT-AS Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HTT-AS Gene

genes like me logo Genes that share expression patterns with HTT-AS: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for HTT-AS Gene

Orthologs for HTT-AS Gene

Evolution for HTT-AS Gene

ENSEMBL:
Gene Tree for HTT-AS (if available)
TreeFam:
Gene Tree for HTT-AS (if available)

No data available for Orthologs for HTT-AS Gene

Paralogs for HTT-AS Gene

No data available for Paralogs for HTT-AS Gene

Variants for HTT-AS Gene

Sequence variations from dbSNP and Humsavar for HTT-AS Gene

SNP ID Clin Chr 04 pos Variation AA Info Type
rs71180116 benign, pathogenic, Huntington's chorea 3,074,877(-) CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA upstream_transcript_variant
rs751281707 benign, not specified 3,074,924(-) GC/ upstream_transcript_variant
rs754481229 benign, not specified 3,074,927(-) GCAG/ upstream_transcript_variant
rs772429544 benign, not specified 3,074,946(-) CCGCCGCCGCCGCCGCCGCCGCC/CCGCCGCC/CCGCCGCCGCC/CCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC/CCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC upstream_transcript_variant
rs587777899 not-provided, not provided 3,074,929(-) A/C upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for HTT-AS Gene

Variant ID Type Subtype PubMed ID
esv28565 CNV gain 19812545
esv3599420 CNV gain 21293372
nsv461163 CNV gain 19166990
nsv593437 CNV gain 21841781

Additional Variant Information for HTT-AS Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
HTT-AS

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for HTT-AS Gene

Disorders for HTT-AS Gene

MalaCards: The human disease database

(1) MalaCards diseases for HTT-AS Gene - From: LncRNADisease, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
huntington disease
  • hd
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for HTT-AS

genes like me logo Genes that share disorders with HTT-AS: view

No data available for UniProtKB/Swiss-Prot and Genatlas for HTT-AS Gene

Publications for HTT-AS Gene

  1. Roles of long noncoding RNAs in brain development, functional diversification and neurodegenerative diseases. (PMID: 23756188) Wu P … Ji A (Brain research bulletin 2013) 2 3 56
  2. A natural antisense transcript at the Huntington's disease repeat locus regulates HTT expression. (PMID: 21672921) Chung DW … Margolis RL (Human molecular genetics 2011) 2 3 56
  3. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K … Sugano S (Genome research 2006) 3 56

Products for HTT-AS Gene

Sources for HTT-AS Gene