Aliases for HTT Gene
Aliases for HTT Gene
External Ids for HTT Gene
- HGNC: 4851
- Entrez Gene: 3064
- Ensembl: ENSG00000197386
- OMIM: 613004
- UniProtKB: P42858
Previous HGNC Symbols for HTT Gene
- HD
Previous GeneCards Identifiers for HTT Gene
- GC04P003046
- GC04P003014
Summaries for HTT Gene
-
Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
GeneCards Summary for HTT Gene
HTT (Huntingtin) is a Protein Coding gene. Diseases associated with HTT include Huntington Disease and Lopes-Maciel-Rodan Syndrome. Among its related pathways are Akt Signaling and Direct p53 effectors. Gene Ontology (GO) annotations related to this gene include identical protein binding and transcription factor binding.
UniProtKB/Swiss-Prot for HTT Gene
-
May play a role in microtubule-mediated transport or vesicle function.
Additional gene information for HTT Gene
- Monarch Initiative
- Search for HTT at DataMed
- Search for HTT at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HTT Gene
Genomics for HTT Gene
GeneHancer (GH) Regulatory Elements for HTT Gene
Promoters and enhancers for HTT Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)
GeneHancers around HTT on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the HTT gene promoter:
-
- c-Jun
- ATF-2
- AP-1
- Sp1
- STAT1
- STAT1alpha
- STAT1beta
Regulatory Element Products
Genomic Locations for HTT Gene
Genomic Locations for HTT Gene
- chr4:3,074,510-3,243,960
- (GRCh38/hg38)
- Size:
- 169,451 bases
- Orientation:
- Plus strand
- chr4:3,076,408-3,245,687
- (GRCh37/hg19)
- Size:
- 169,280 bases
- Orientation:
- Plus strand
Genomic View for HTT Gene
Genes around HTT on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 4p16.3 by Entrez Gene
- 4p16.3 by HGNC
- 4p16.3 by Ensembl
HTT Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for HTT Gene
Proteins for HTT Gene
-
Protein details for HTT Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P42858-HD_HUMAN
- Recommended name:
- Huntingtin
- Protein Accession:
- P42858
- Q9UQB7
Protein attributes for HTT Gene
- Size:
- 3142 amino acids
- Molecular mass:
- 347603 Da
- Quaternary structure:
-
- Interacts with PFN1 (PubMed:18573880). Interacts through its N-terminus with PRPF40A (PubMed:9700202). Interacts with PQBP1 (PubMed:10332029). Interacts with SETD2 (PubMed:9700202, PubMed:10958656, PubMed:11461154). Interacts with SH3GLB1 (By similarity). Interacts with SYVN (PubMed:17141218). Interacts with TPR; the interaction is inhibited by forms of Huntingtin with expanded polyglutamine stretch (PubMed:15654337). Interacts with ZDHHC13 (via ANK repeats) (PubMed:26198635). Interacts with ZDHHC17 (via ANK repeats) (PubMed:26198635, PubMed:28882895, PubMed:28757145).
Protein Expression for HTT Gene
Post-translational modifications for HTT Gene
- Cleaved by apopain downstream of the polyglutamine stretch. The resulting N-terminal fragment is cytotoxic and provokes apoptosis.
- Forms with expanded polyglutamine expansion are specifically ubiquitinated by SYVN1, which promotes their proteasomal degradation.
- Phosphorylation at Ser-1179 and Ser-1199 by CDK5 in response to DNA damage in nuclei of neurons protects neurons against polyglutamine expansion as well as DNA damage mediated toxicity.
- Ubiquitination at Lys2417, isoforms=1431, isoforms=1402, and Lys1262
- Modification sites at PhosphoSitePlus
Other Protein References for HTT Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for HTT
- Novus Biologicals Antibodies for HTT
-
Abcam antibodies for HTT
- Invitrogen Antibodies for HTT (AFLGC-HTT)
- antibodies-online: Search results for 164 available Huntingtin Antibodies ranked by validation data
- Compare Top Huntingtin Antibodies
-
Recommended
- 125 WB Antibodies (anti-human)
- 12 IF (p) Antibodies (anti-human)
- 5 IHC (p) Antibodies (anti-human)
- 4 IHC Antibodies (anti-human)
- 1 ICC Antibody (anti-human)
- 1 IHC (fro) Antibody (anti-human)
- 1 IP Antibody (anti-human)
- 79 WB Antibodies (anti-mouse)
- 12 IF (p) Antibodies (anti-mouse)
- 4 IHC (p) Antibodies (anti-mouse)
- 3 IHC Antibodies (anti-mouse)
- 1 IHC (fro) Antibody (anti-mouse)
- 41 WB Antibodies (anti-rat)
- 12 IF (p) Antibodies (anti-rat)
- 3 IHC Antibodies (anti-rat)
- 3 IHC (p) Antibodies (anti-rat)
- GeneTex HTT Antibody for HTT
-
Santa Cruz Biotechnology (SCBT) Antibodies for HTT
Protein Products
-
OriGene Purified Proteins for HTT
- Search Origene for MassSpec and Protein Over-expression Lysates for HTT
- Origene Custom Protein Services for HTT
- Novus Biologicals proteins for HTT
- Search GeneTex for Proteins for HTT
-
Abcam proteins for HTT
Assay Products
No data available for DME Specific Peptides for HTT Gene
Domains & Families for HTT Gene
Gene Families for HTT Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Plasma proteins
- Predicted intracellular proteins
- Predicted membrane proteins
Protein Domains for HTT Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for HTT Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P42858UniProtKB/Swiss-Prot:
HD_HUMAN :- The N-terminal Gln-rich and Pro-rich domain has great conformational flexibility and is likely to exist in a fluctuating equilibrium of alpha-helical, random coil, and extended conformations.
- Belongs to the huntingtin family.
- Domain:
-
- The N-terminal Gln-rich and Pro-rich domain has great conformational flexibility and is likely to exist in a fluctuating equilibrium of alpha-helical, random coil, and extended conformations.
- Family:
-
- Belongs to the huntingtin family.
Function for HTT Gene
Molecular function for HTT Gene
- UniProtKB/Swiss-Prot Function:
- May play a role in microtubule-mediated transport or vesicle function.
Phenotypes From GWAS Catalog for HTT Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0002039 | p53 binding | IPI | 10823891 |
| GO:0005488 | binding | IEA | -- |
| GO:0005515 | protein binding | IPI | 7477378 |
| GO:0005522 | profilin binding | IPI | 18573880 |
| GO:0008134 | transcription factor binding | IBA | -- |
Phenotypes for HTT Gene
- MGI mutant phenotypes for HTT:
-
inferred from 34 alleles
- cardiovascular system phenotype
- homeostasis/metabolism phenotype
- nervous system phenotype
- behavior/neurological phenotype
- no phenotypic analysis
- integument phenotype
- taste/olfaction phenotype
- endocrine/exocrine gland phenotype
- mortality/aging
- cellular phenotype
- craniofacial phenotype
- reproductive system phenotype
- skeleton phenotype
- embryo phenotype
- normal phenotype
- hearing/vestibular/ear phenotype
- hematopoietic system phenotype
- immune system phenotype
- growth/size/body region phenotype
- GenomeRNAi human phenotypes for HTT:
-
- Decreased HPV16-GFP infection
- Increased shRNA abundance (Z-score > 2)
- Moderately decreased NFAT1-GFP nuclear translocation
- Decreased shRNA abundance (Z-score < -2)
- Increased Nanog expression
- Decreased viability
- no effect
- Decreased Aire reporter expression
- Increased vaccinia virus (VACV) infection
- Increased transferrin (TF) endocytosis
- Synthetic lethal with MLN4924 (a NAE inhibitor)
Animal Models for HTT Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for HTT
-
CRISPR Products
-
OriGene CRISPR knockouts for HTT
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for HTT
- genomics-online: gRNA clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
- Applied Biological Materials CRISPR for HTT
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for HTT
- GenScript: Design CRISPR guide RNA sequences for HTT
miRNA for HTT Gene
- miRTarBase miRNAs that target HTT
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for HTT
- Browse OriGene Inhibitory RNA Products For HTT
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for HTT
- genomics-online: shRNA clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
Clone Products
-
OriGene ORF clones in human for HTT
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Addgene plasmids for HTT
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for HTT
- Applied Biological Materials Clones for HTT
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for HTT
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for HTT Gene
Localization for HTT Gene
Subcellular locations from UniProtKB/Swiss-Prot for HTT Gene
- Cytoplasm. Nucleus. Note=The mutant Huntingtin protein colocalizes with AKAP8L in the nuclear matrix of Huntington disease neurons. Shuttles between cytoplasm and nucleus in a Ran GTPase-independent manner. {ECO:0000269 PubMed:15654337}.
| Compartment | Confidence |
|---|---|
| cytoskeleton | 5 |
| nucleus | 5 |
| endoplasmic reticulum | 5 |
| cytosol | 5 |
| golgi apparatus | 5 |
| endosome | 5 |
| plasma membrane | 4 |
| mitochondrion | 3 |
| lysosome | 2 |
| extracellular | 1 |
- Cytosol (3)
- Nucleoplasm (3)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005634 | nucleus | IMP | 17947297 |
| GO:0005654 | nucleoplasm | IDA | -- |
| GO:0005737 | cytoplasm | IMP | 17947297 |
| GO:0005770 | late endosome | IDA | 17704510 |
| GO:0005776 | autophagosome | IDA | 17704510 |
Pathways & Interactions for HTT Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins. | ||
| 2 | Neuroscience | ||
| 3 | PI3K / Akt Signaling | ||
| 4 | Akt Signaling |
.60
|
|
| 5 | fMLP Pathway | ||
Pathways by source for HTT Gene
2 BioSystems pathways for HTT Gene
1 KEGG pathway for HTT Gene
2 Qiagen pathways for HTT Gene
2 Cell Signaling Technology pathways for HTT Gene
Interacting Proteins for HTT Gene
Selected Interacting proteins:
P42858-HD_HUMAN
ENSP00000347184
for HTT Gene via
UniProtKB
MINT
STRING
IID
GPS-Prot Interaction Network for HTT
SIGNOR curated interactions for HTT Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000132 | establishment of mitotic spindle orientation | IMP | 20696378 |
| GO:0006890 | retrograde vesicle-mediated transport, Golgi to ER | IMP | 20515468 |
| GO:0006915 | apoptotic process | IEA | -- |
| GO:0007030 | Golgi organization | IMP | 20515468 |
| GO:0031587 | positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity | IDA | 12873381 |
Transcripts for HTT Gene
mRNA/cDNA for HTT Gene
- (1) REFSEQ mRNAs :
- (6) Additional mRNA sequences :
- (256) Selected AceView cDNA sequences:
- (13) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000355072 13475 bps (uc062uto.1)
- ENST00000506137 781 bps (uc062utp.1)
- ENST00000512909 611 bps (uc062utq.1)
- ENST00000510626 14438 bps (uc062utr.1)
- ENST00000509618 429 bps (uc062uts.1)
CRISPR Products
-
OriGene CRISPR knockouts for HTT
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for HTT
- genomics-online: gRNA clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
- Applied Biological Materials CRISPR for HTT
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for HTT
- GenScript: Design CRISPR guide RNA sequences for HTT
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for HTT
- Browse OriGene Inhibitory RNA Products For HTT
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for HTT
- genomics-online: shRNA clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
Clone Products
-
OriGene ORF clones in human for HTT
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Addgene plasmids for HTT
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for HTT
- Applied Biological Materials Clones for HTT
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for HTT Gene
This gene is overexpressed in Peripheral blood mononuclear cells (18.3).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for HTT Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of HTT Gene:
HTTSOURCE GeneReport for Unigene cluster for HTT Gene:
Hs.518450mRNA Expression by UniProt/SwissProt for HTT Gene:
P42858-HD_HUMAN
Tissue specificity:
Expressed in the brain cortex (at protein level). Widely expressed with the highest level of expression in the brain (nerve fibers, varicosities, and nerve endings). In the brain, the regions where it can be mainly found are the cerebellar cortex, the neocortex, the striatum, and the hippocampal formation.
Evidence on tissue expression from TISSUES for HTT Gene
- Nervous system(4.9)
- Blood(4.5)
- Eye(4.5)
- Muscle(4.3)
- Liver(4.2)
- Lung(3)
- Adrenal gland(2.2)
Phenotype-based relationships between genes and organs from Gene ORGANizer for HTT Gene
Germ Layers:
- ectoderm
- mesoderm
Systems:
- nervous
- skeletal muscle
- skeleton
Regions:
Head and neck:
- brain
- cerebellum
- eye
- head
- larynx
- neck
- vocal cord
General:
- spinal cord
Primer Products
-
OriGene qPCR primer pairs for HTT
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for HTT Gene
Orthologs for HTT Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | HTT 34 33 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | HD 34 |
|
OneToOne | |
| HTT 33 |
|
||||
| mouse (Mus musculus) |
Mammalia | Htt 16 34 33 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Htt 33 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | HTT 34 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | HTT 34 33 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | HTT 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | HTT 34 33 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | -- 34 |
|
OneToMany | |
| -- 34 |
|
OneToMany | |||
| tropical clawed frog (Silurana tropicalis) |
Amphibia | htt 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | htt 34 33 |
|
OneToOne | |
| hd 33 |
|
||||
| fruit fly (Drosophila melanogaster) |
Insecta | htt 34 |
|
OneToOne | |
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToOne |
- Species where no ortholog for HTT was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Evolution for HTT Gene
- ENSEMBL:
- Gene Tree for HTT (if available)
- TreeFam:
- Gene Tree for HTT (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for HTT: view image
Paralogs for HTT Gene
(1) SIMAP similar genes for HTT Gene using alignment to 2 proteins:
- HD_HUMAN
- H0YA07_HUMAN
No data available for Paralogs for HTT Gene
Variants for HTT Gene
Polymorphic Variants from UniProtKB/Swiss-Prot for HTT Gene
- HD_HUMAN-P42858
- The poly-Gln region of HTT is highly polymorphic (10 to 35 repeats) in the normal population and is expanded to about 36-120 repeats in Huntington disease patients. The repeat length usually increases in successive generations, but contracts also on occasion. The adjacent poly-Pro region is also polymorphic and varies between 7-12 residues. Polyglutamine expansion leads to elevated susceptibility to apopain cleavage and likely result in accelerated neuronal apoptosis (PubMed:8696339).
| SNP ID | Clin | Chr 04 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1060505027 | pathogenic, uncertain-significance, Lopes-Maciel-Rodan syndrome, not specified | 3,177,388(+) | G/A | splice_donor_variant | |
| rs1060505028 | pathogenic, Lopes-Maciel-Rodan syndrome | 3,229,927(+) | T/A | coding_sequence_variant, missense_variant | |
| rs34315806 | pathogenic, Lopes-Maciel-Rodan syndrome | 3,160,307(+) | C/T | coding_sequence_variant, missense_variant | |
| rs71180116 | benign, pathogenic, Huntington's chorea | 3,074,877(+) | CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | coding_sequence_variant, inframe_deletion, inframe_insertion | |
| rs768047421 | pathogenic, Lopes-Maciel-Rodan syndrome, Lopes-Maciel-Rodan syndrome (LOMARS) [MIM:617435] | 3,131,647(+) | C/T | coding_sequence_variant, missense_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| esv2667257 | CNV | deletion | 23128226 |
| esv2726869 | CNV | deletion | 23290073 |
| esv2726870 | CNV | deletion | 23290073 |
| esv3376417 | CNV | duplication | 20981092 |
| esv3387920 | CNV | insertion | 20981092 |
| esv3599421 | CNV | loss | 21293372 |
| esv3599422 | CNV | loss | 21293372 |
| esv8475 | CNV | loss | 19470904 |
| nsv1123741 | CNV | deletion | 24896259 |
| nsv461163 | CNV | gain | 19166990 |
| nsv461164 | CNV | loss | 19166990 |
| nsv470003 | CNV | loss | 18288195 |
| nsv524211 | CNV | loss | 19592680 |
| nsv593437 | CNV | gain | 21841781 |
| nsv593439 | CNV | loss | 21841781 |
| nsv949760 | CNV | deletion | 24416366 |
Residual Variation Intolerance Score:
0.145% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
22.05;
99.38% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for HTT Gene
SNP Genotyping and Copy Number Assay Products
Disorders for HTT Gene
(17) MalaCards diseases for HTT Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| huntington disease |
|
|
| lopes-maciel-rodan syndrome |
|
|
| spinal and bulbar muscular atrophy, x-linked 1 |
|
|
| spinocerebellar ataxia 1 |
|
|
| dentatorubral-pallidoluysian atrophy |
|
Search HTT in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
HD_HUMAN- Huntington disease (HD) [MIM:143100]: A neurodegenerative disorder characterized by involuntary movements (chorea), general motor impairment, psychiatric disorders and dementia. Onset of the disease occurs usually in the third or fourth decade of life. Onset and clinical course depend on the degree of poly-Gln repeat expansion, longer expansions resulting in earlier onset and more severe clinical manifestations. Neuropathology of Huntington disease displays a distinctive pattern with loss of neurons, especially in the caudate and putamen. Note=The disease is caused by mutations affecting the gene represented in this entry.
- Lopes-Maciel-Rodan syndrome (LOMARS) [MIM:617435]: An autosomal recessive neurodevelopmental disorder characterized by developmental regression in infancy, delayed psychomotor development, severe intellectual disability, and cerebral and cerebellar atrophy. Additional features include swallowing problems, dystonia, bradykinesia, and continuous manual stereotypies without chorea. Some patients manifest seizures. {ECO:0000269 PubMed:26740508, ECO:0000269 PubMed:27329733}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for HTT
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for HTT Gene
Publications for HTT Gene
- A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's Disease Collaborative Research Group. (PMID: 8458085) (Cell 1993) 2 3 4 22 58
- Normal and mutant HTT interact to affect clinical severity and progression in Huntington disease. (PMID: 19776381) Aziz NA … Roos RA (Neurology 2009) 3 22 44 58
- Huntington CAG repeat size does not modify onset age in familial Parkinson's disease: the GenePD study. (PMID: 18649400) McNicoll CF … Myers RH (Movement disorders : official journal of the Movement Disorder Society 2008) 3 22 44 58
- Phosphorylation of profilin by ROCK1 regulates polyglutamine aggregation. (PMID: 18573880) Shao J … Diamond MI (Molecular and cellular biology 2008) 3 4 22 58
- Phosphorylation of huntingtin by cyclin-dependent kinase 5 is induced by DNA damage and regulates wild-type and mutant huntingtin toxicity in neurons. (PMID: 17611284) Anne SL … Humbert S (The Journal of neuroscience : the official journal of the Society for Neuroscience 2007) 3 4 22 58
Products for HTT Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for HTT
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for HTT
- Search Origene for MassSpec and Protein Over-expression Lysates for HTT
- Origene Custom Protein Services for HTT
- Origene shrna, sirna, and RNAi products in human, mouse, rat for HTT
- Browse OriGene Inhibitory RNA Products For HTT
- OriGene qPCR primer pairs for HTT
- OriGene CRISPR knockouts for HTT
- OriGene ORF clones in human for HTT
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For HTT
- GenScript: Next-day shipping of latest version cDNA ORF clones for HTT in any vector
- GenScript Custom Purified and Recombinant Proteins Services for HTT
- GenScript Custom Assay Services for HTT
- GenScript Custom overexpressing Cell Line Services for HTT
- GenScript: Design CRISPR guide RNA sequences for HTT
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for HTT
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for HTT
- Novus Biologicals proteins for HTT
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for HTT
- Abcam proteins for HTT
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for HTT (AFLGC-HTT)
- Cyagen custom Knockout/knockin (KOKI) mouse models for HTT
- Addgene plasmids for HTT
- antibodies-online: Search results for 164 available Huntingtin Antibodies ranked by validation data
- Compare Top Huntingtin Antibodies
- Recommended
- 125 WB Antibodies (anti-human)
- 12 IF (p) Antibodies (anti-human)
- 5 IHC (p) Antibodies (anti-human)
- 4 IHC Antibodies (anti-human)
- 1 ICC Antibody (anti-human)
- 1 IHC (fro) Antibody (anti-human)
- 1 IP Antibody (anti-human)
- 79 WB Antibodies (anti-mouse)
- 12 IF (p) Antibodies (anti-mouse)
- 4 IHC (p) Antibodies (anti-mouse)
- 3 IHC Antibodies (anti-mouse)
- 1 IHC (fro) Antibody (anti-mouse)
- 41 WB Antibodies (anti-rat)
- 12 IF (p) Antibodies (anti-rat)
- 3 IHC Antibodies (anti-rat)
- 3 IHC (p) Antibodies (anti-rat)
- antibodies-online: Search results for 25 available Huntingtin Elisa Kits ranked by validation data
- Compare Top Huntingtin Elisa Kits
- antibodies-online: Search results for 2 available Huntingtin Proteins ranked by validation data
- Compare Top Huntingtin Proteins
- GeneTex HTT Antibody for HTT
- Search GeneTex for Proteins for HTT
- Santa Cruz Biotechnology (SCBT) Antibodies for HTT
- Search Santa Cruz Biotechnology (SCBT) for HTT siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for HTT
- Horizon Cell Lines for HTT
- genomics-online: cdna clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
- orf clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
- genomics-online: gRNA clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
- genomics-online: primer clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
- genomics-online: shRNA clones - Search results for 66 available Huntingtin gene related products
- Overview of 66 available Huntingtin gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for HTT
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for HTT
- GeneCopoeia miRNA 3'UTR Target clone products for HTT
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for HTT
Sources for HTT Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio
- (169) Biorbyt