Free for academic non-profit institutions. Other users need a Commercial license

HTT Gene(Protein Coding)

Huntingtin

GCID:
GC04P003076
GIFtS:
53
Genes Participants
UDN Logo

Aliases for HTT Gene

Aliases for HTT Gene

  • Huntingtin 2 3 3 5
  • Huntington Disease Protein 3 4
  • IT15 3 4
  • HD 3 4
  • Huntingtin (Huntington Disease) 2
  • HD Protein 4
  • LOMARS 3

External Ids for HTT Gene

Previous HGNC Symbols for HTT Gene

  • HD

Previous GeneCards Identifiers for HTT Gene

  • GC04P003046
  • GC04P003014

Summaries for HTT Gene

Entrez Gene Summary for HTT Gene

  • Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

GeneCards Summary for HTT Gene

HTT (Huntingtin) is a Protein Coding gene. Diseases associated with HTT include Huntington Disease and Lopes-Maciel-Rodan Syndrome. Among its related pathways are Mesodermal Commitment Pathway and Direct p53 effectors. Gene Ontology (GO) annotations related to this gene include identical protein binding and transcription factor binding.

UniProtKB/Swiss-Prot for HTT Gene

  • May play a role in microtubule-mediated transport or vesicle function.

Gene Wiki entry for HTT Gene

Additional gene information for HTT Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HTT Gene

Genomics for HTT Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for HTT Gene

Promoters and enhancers for HTT Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH04I003073 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 555.4 +0.7 664 3.5 HDGF PKNOX1 FOXA2 SMAD1 MLX ARID4B SIN3A DMAP1 YY1 POLR2B HTT GC04P003074 HTT-AS RNF4 FAM193A HAUS3 MSANTD1 DOK7 NOP14-AS1 GC04M003078
GH04I002930 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 10.4 -140.3 -140308 8.2 HDGF PKNOX1 SMAD1 FOXA2 MLX ARID4B SIN3A DMAP1 ZNF2 IRF4 NOP14-AS1 MFSD10 GRK4 HTT HTT-AS GC04P002904 PIR46708 NOP14
GH04I003110 Enhancer 1 Ensembl ENCODE 20.3 +37.7 37714 3.4 PKNOX1 CLOCK NEUROD1 BMI1 RCOR1 FOS GATAD2B ELF1 ZNF592 SREBF1 HTT HTT-AS RNU6-204P RNU7-33P MSANTD1 GC04M003105 GC04P003121
GH04I002857 Enhancer 1.4 Ensembl ENCODE dbSUPER 10.5 -214.0 -214031 5.7 PKNOX1 FOXA2 ARID4B FEZF1 IRF4 YY1 TCF12 ZNF213 KLF7 RUNX3 GRK4 NOP14-AS1 NOP14 TNIP2 HTT ADD1 GC04P002845 GC04P002844 GC04P002843 GC04P002904
GH04I003037 Enhancer 1 Ensembl ENCODE 11.9 -36.6 -36586 1.8 ARNT ZSCAN4 ARID4B ZNF2 RAD21 ZNF335 ZNF207 ZNF143 BCLAF1 RUNX3 RNF4 HAUS3 HTT HTT-AS RNU7-33P GRK4 GC04P003044 GC04M003004
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around HTT on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HTT gene promoter:

Genomic Locations for HTT Gene

Genomic Locations for HTT Gene
chr4:3,074,510-3,243,960
(GRCh38/hg38)
Size:
169,451 bases
Orientation:
Plus strand
chr4:3,076,408-3,245,687
(GRCh37/hg19)

Genomic View for HTT Gene

Genes around HTT on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HTT Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HTT Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for HTT Gene

Proteins for HTT Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for HTT Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P42858-HD_HUMAN
    Recommended name:
    Huntingtin
    Protein Accession:
    P42858
    Secondary Accessions:
    • Q9UQB7

    Protein attributes for HTT Gene

    Size:
    3142 amino acids
    Molecular mass:
    347603 Da
    Quaternary structure:
    • Interacts with PFN1 (PubMed:18573880). Interacts through its N-terminus with PRPF40A (PubMed:9700202). Interacts with PQBP1 (PubMed:10332029). Interacts with SETD2 (PubMed:9700202, PubMed:10958656, PubMed:11461154). Interacts with SH3GLB1 (By similarity). Interacts with SYVN (PubMed:17141218). Interacts with TPR; the interaction is inhibited by forms of Huntingtin with expanded polyglutamine stretch (PubMed:15654337). Interacts with ZDHHC13 (via ANK repeats) (PubMed:26198635). Interacts with ZDHHC17 (via ANK repeats) (PubMed:26198635, PubMed:28882895, PubMed:28757145).

    Three dimensional structures from OCA and Proteopedia for HTT Gene

neXtProt entry for HTT Gene

Protein Expression for HTT Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for HTT Gene

  • Cleaved by apopain downstream of the polyglutamine stretch. The resulting N-terminal fragment is cytotoxic and provokes apoptosis.
  • Forms with expanded polyglutamine expansion are specifically ubiquitinated by SYVN1, which promotes their proteasomal degradation.
  • Phosphorylation at Ser-1179 and Ser-1199 by CDK5 in response to DNA damage in nuclei of neurons protects neurons against polyglutamine expansion as well as DNA damage mediated toxicity.
  • Ubiquitination at posLast=12621262, posLast=14021402, posLast=14311431, and posLast=24172417

Other Protein References for HTT Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for HTT Gene

Domains & Families for HTT Gene

Gene Families for HTT Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for HTT Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for HTT Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P42858

UniProtKB/Swiss-Prot:

HD_HUMAN :
  • The N-terminal Gln-rich and Pro-rich domain has great conformational flexibility and is likely to exist in a fluctuating equilibrium of alpha-helical, random coil, and extended conformations.
  • Belongs to the huntingtin family.
Domain:
  • The N-terminal Gln-rich and Pro-rich domain has great conformational flexibility and is likely to exist in a fluctuating equilibrium of alpha-helical, random coil, and extended conformations.
Family:
  • Belongs to the huntingtin family.
genes like me logo Genes that share domains with HTT: view

Function for HTT Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for HTT Gene

UniProtKB/Swiss-Prot Function:
May play a role in microtubule-mediated transport or vesicle function.

Phenotypes From GWAS Catalog for HTT Gene

Gene Ontology (GO) - Molecular Function for HTT Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002039 p53 binding IPI 10823891
GO:0005319 lipid transporter activity IEA --
GO:0005515 protein binding IPI 7477378
GO:0005522 profilin binding IPI 18573880
GO:0008134 transcription factor binding IBA --
genes like me logo Genes that share ontologies with HTT: view
genes like me logo Genes that share phenotypes with HTT: view

Human Phenotype Ontology for HTT Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for HTT Gene

MGI Knock Outs for HTT:

Animal Model Products

Clone Products

  • Addgene plasmids for HTT

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for HTT Gene

Localization for HTT Gene

Subcellular locations from UniProtKB/Swiss-Prot for HTT Gene

Cytoplasm. Nucleus. Note=The mutant Huntingtin protein colocalizes with AKAP8L in the nuclear matrix of Huntington disease neurons. Shuttles between cytoplasm and nucleus in a Ran GTPase-independent manner. {ECO:0000269 PubMed:15654337}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HTT gene
Compartment Confidence
cytoskeleton 5
nucleus 5
endoplasmic reticulum 5
cytosol 5
golgi apparatus 5
endosome 5
plasma membrane 4
mitochondrion 3
lysosome 2
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for HTT Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IMP 17947297
GO:0005654 nucleoplasm IDA --
GO:0005737 cytoplasm IMP 17947297
GO:0005770 late endosome IDA 17704510
GO:0005776 autophagosome IDA 17704510
genes like me logo Genes that share ontologies with HTT: view

Pathways & Interactions for HTT Gene

genes like me logo Genes that share pathways with HTT: view

Pathways by source for HTT Gene

2 Cell Signaling Technology pathways for HTT Gene
2 BioSystems pathways for HTT Gene
1 KEGG pathway for HTT Gene
2 Qiagen pathways for HTT Gene

SIGNOR curated interactions for HTT Gene

Is activated by:
Is inactivated by:
Other effect:

Gene Ontology (GO) - Biological Process for HTT Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000132 establishment of mitotic spindle orientation IMP 20696378
GO:0006869 lipid transport IEA --
GO:0006890 retrograde vesicle-mediated transport, Golgi to ER IMP 20515468
GO:0006915 apoptotic process IEA --
GO:0007030 Golgi organization IMP 20515468
genes like me logo Genes that share ontologies with HTT: view

Drugs & Compounds for HTT Gene

Products:

  1. Drug

(33) Drugs for HTT Gene - From: DrugBank and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Copper Approved, Investigational Pharma Target 202

(20) Additional Compounds for HTT Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with HTT: view

Transcripts for HTT Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for HTT Gene

(1) REFSEQ mRNAs :
(6) Additional mRNA sequences :
(256) Selected AceView cDNA sequences:
(13) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HTT Gene

Huntingtin:
Representative Sequences:

Clone Products

  • Addgene plasmids for HTT

Alternative Splicing Database (ASD) splice patterns (SP) for HTT Gene

No ASD Table

Relevant External Links for HTT Gene

GeneLoc Exon Structure for
HTT
ECgene alternative splicing isoforms for
HTT

Expression for HTT Gene

Products:

  1. Primer

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HTT Gene

mRNA expression in normal human tissues for HTT Gene
mRNA expression by BioGPS for HTT GenemRNA expression by GTEx for HTT Gene

Protein differential expression in normal tissues from HIPED for HTT Gene

This gene is overexpressed in Peripheral blood mononuclear cells (18.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for HTT Gene



Protein tissue co-expression partners for HTT Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of HTT Gene:

HTT

SOURCE GeneReport for Unigene cluster for HTT Gene:

Hs.518450

mRNA Expression by UniProt/SwissProt for HTT Gene:

P42858-HD_HUMAN
Tissue specificity: Expressed in the brain cortex (at protein level). Widely expressed with the highest level of expression in the brain (nerve fibers, varicosities, and nerve endings). In the brain, the regions where it can be mainly found are the cerebellar cortex, the neocortex, the striatum, and the hippocampal formation.

Evidence on tissue expression from TISSUES for HTT Gene

  • Nervous system(4.9)
  • Blood(4.5)
  • Eye(4.5)
  • Muscle(4.3)
  • Liver(4.2)
  • Lung(3)
  • Adrenal gland(2.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for HTT Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • nervous
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cerebellum
  • eye
  • head
  • larynx
  • neck
  • vocal cord
General:
  • spinal cord
genes like me logo Genes that share expression patterns with HTT: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for HTT Gene

Orthologs for HTT Gene

This gene was present in the common ancestor of animals.

Orthologs for HTT Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia HTT 33 34
  • 98.62 (n)
dog
(Canis familiaris)
 Mammalia HD 34
  • 91 (a)
 OneToOne
HTT 33
  • 87.27 (n)
mouse
(Mus musculus)
 Mammalia Htt 33 16 34
  • 86.38 (n)
rat
(Rattus norvegicus)
 Mammalia Htt 33
  • 86.11 (n)
oppossum
(Monodelphis domestica)
 Mammalia HTT 34
  • 86 (a)
 OneToOne
cow
(Bos Taurus)
 Mammalia HTT 33 34
  • 84.14 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia HTT 34
  • 83 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves HTT 33 34
  • 75.5 (n)
lizard
(Anolis carolinensis)
 Reptilia -- 34
  • 87 (a)
 OneToMany
-- 34
  • 78 (a)
 OneToMany
tropical clawed frog
(Silurana tropicalis)
 Amphibia htt 33
  • 72.18 (n)
zebrafish
(Danio rerio)
 Actinopterygii htt 33 34
  • 69.1 (n)
hd 33
fruit fly
(Drosophila melanogaster)
 Insecta htt 34
  • 17 (a)
 OneToOne
sea squirt
(Ciona savignyi)
 Ascidiacea -- 34
  • 33 (a)
 OneToOne
Species where no ortholog for HTT was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for HTT Gene

ENSEMBL:
Gene Tree for HTT (if available)
TreeFam:
Gene Tree for HTT (if available)

Paralogs for HTT Gene

(1) SIMAP similar genes for HTT Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with HTT: view

No data available for Paralogs for HTT Gene

Variants for HTT Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for HTT Gene

HD_HUMAN-P42858
The poly-Gln region of HTT is highly polymorphic (10 to 35 repeats) in the normal population and is expanded to about 36-120 repeats in Huntington disease patients. The repeat length usually increases in successive generations, but contracts also on occasion. The adjacent poly-Pro region is also polymorphic and varies between 7-12 residues. Polyglutamine expansion leads to elevated susceptibility to apopain cleavage and likely result in accelerated neuronal apoptosis (PubMed:8696339).

Sequence variations from dbSNP and Humsavar for HTT Gene

SNP ID Clin Chr 04 pos Variation AA Info Type
rs1060505027 pathogenic, uncertain-significance, Lopes-Maciel-Rodan syndrome, not specified 3,177,388(+) G/A splice_donor_variant
rs1060505028 pathogenic, Lopes-Maciel-Rodan syndrome 3,229,927(+) T/A coding_sequence_variant, missense_variant
rs34315806 pathogenic, Lopes-Maciel-Rodan syndrome 3,160,307(+) C/T coding_sequence_variant, missense_variant
rs71180116 benign, pathogenic, Huntington's chorea 3,074,877(+) CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA coding_sequence_variant, inframe_deletion, inframe_insertion
rs768047421 pathogenic, Lopes-Maciel-Rodan syndrome, Lopes-Maciel-Rodan syndrome (LOMARS) [MIM:617435] 3,131,647(+) C/T coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for HTT Gene

Variant ID Type Subtype PubMed ID
nsv949760 CNV deletion 24416366
nsv593439 CNV loss 21841781
nsv593437 CNV gain 21841781
nsv524211 CNV loss 19592680
nsv470003 CNV loss 18288195
nsv461164 CNV loss 19166990
nsv461163 CNV gain 19166990
nsv1123741 CNV deletion 24896259
esv8475 CNV loss 19470904
esv3599422 CNV loss 21293372
esv3599421 CNV loss 21293372
esv3387920 CNV insertion 20981092
esv3376417 CNV duplication 20981092
esv2726870 CNV deletion 23290073
esv2726869 CNV deletion 23290073
esv2667257 CNV deletion 23128226

Variation tolerance for HTT Gene

Residual Variation Intolerance Score: 0.145% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 22.05; 99.38% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HTT Gene

Human Gene Mutation Database (HGMD)
HTT
SNPedia medical, phenotypic, and genealogical associations of SNPs for
HTT

Disorders for HTT Gene

MalaCards: The human disease database

(16) MalaCards diseases for HTT Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search HTT in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

HD_HUMAN
  • Huntington disease (HD) [MIM:143100]: A neurodegenerative disorder characterized by involuntary movements (chorea), general motor impairment, psychiatric disorders and dementia. Onset of the disease occurs usually in the third or fourth decade of life. Onset and clinical course depend on the degree of poly-Gln repeat expansion, longer expansions resulting in earlier onset and more severe clinical manifestations. Neuropathology of Huntington disease displays a distinctive pattern with loss of neurons, especially in the caudate and putamen. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Lopes-Maciel-Rodan syndrome (LOMARS) [MIM:617435]: An autosomal recessive neurodevelopmental disorder characterized by developmental regression in infancy, delayed psychomotor development, severe intellectual disability, and cerebral and cerebellar atrophy. Additional features include swallowing problems, dystonia, bradykinesia, and continuous manual stereotypies without chorea. Some patients manifest seizures. {ECO:0000269 PubMed:26740508, ECO:0000269 PubMed:27329733}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for HTT

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with HTT: view

No data available for Genatlas for HTT Gene

Publications for HTT Gene

  1. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's Disease Collaborative Research Group. (PMID: 8458085) (Cell 1993) 2 3 4 22 58
  2. Normal and mutant HTT interact to affect clinical severity and progression in Huntington disease. (PMID: 19776381) Aziz NA … Roos RA (Neurology 2009) 3 22 44 58
  3. Phosphorylation of profilin by ROCK1 regulates polyglutamine aggregation. (PMID: 18573880) Shao J … Diamond MI (Molecular and cellular biology 2008) 3 4 22 58
  4. Huntington CAG repeat size does not modify onset age in familial Parkinson's disease: the GenePD study. (PMID: 18649400) McNicoll CF … Myers RH (Movement disorders : official journal of the Movement Disorder Society 2008) 3 22 44 58
  5. Phosphorylation of huntingtin by cyclin-dependent kinase 5 is induced by DNA damage and regulates wild-type and mutant huntingtin toxicity in neurons. (PMID: 17611284) Anne SL … Humbert S (The Journal of neuroscience : the official journal of the Society for Neuroscience 2007) 3 4 22 58

Products for HTT Gene

  • Addgene plasmids for HTT

Sources for HTT Gene

Content
Loading form....