Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HTR1F Gene

Aliases for HTR1F Gene

  • 5-Hydroxytryptamine Receptor 1F 2 3 3 5
  • 5-Hydroxytryptamine (Serotonin) Receptor 1F, G Protein-Coupled 2 3
  • Serotonin Receptor 1F 3 4
  • 5-HT-1F 3 4
  • 5-HT1F 3 4
  • HTR1EL 3 4
  • 5-Hydroxytryptamine (Serotonin) Receptor 1F 2
  • 5HT6 3
  • MR77 3

External Ids for HTR1F Gene

Previous GeneCards Identifiers for HTR1F Gene

  • GC03P088567
  • GC03P090821
  • GC03P087919
  • GC03P087960
  • GC03P088122
  • GC03P088031

Summaries for HTR1F Gene

GeneCards Summary for HTR1F Gene

HTR1F (5-Hydroxytryptamine Receptor 1F) is a Protein Coding gene. Diseases associated with HTR1F include Migraine With Or Without Aura 1. Among its related pathways are GPCRs, Other and Monoamine GPCRs. Gene Ontology (GO) annotations related to this gene include G-protein coupled receptor activity and serotonin binding. An important paralog of this gene is HTR1E.

UniProtKB/Swiss-Prot for HTR1F Gene

  • G-protein coupled receptor for 5-hydroxytryptamine (serotonin). Also functions as a receptor for various alkaloids and psychoactive substances. Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors, such as adenylate cyclase. Signaling inhibits adenylate cyclase activity.

Tocris Summary for HTR1F Gene

  • Serotonin 5-HT1F receptors, previously known as 5-HT1Ebeta receptors, are located primarily in the hippocampus, cortex and dorsal raphe nucleus. The human 5-HT1F receptor is closely related to the 5-ht1E receptor and its gene has been localized to chromosome 3 (3q11).

Gene Wiki entry for HTR1F Gene

Additional gene information for HTR1F Gene

No data available for Entrez Gene Summary , CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HTR1F Gene

Genomics for HTR1F Gene

GeneHancer (GH) Regulatory Elements for HTR1F Gene

Promoters and enhancers for HTR1F Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J087791 Enhancer 1.3 Ensembl ENCODE dbSUPER 658.9 +0.6 596 2.9 HDAC1 RB1 ZNF335 GLIS2 ZNF213 RBM34 EGR1 ZNF202 ZNF680 ZBTB11 HTR1F LOC105377198 CGGBP1 ZNF654 VGLL3
GH03J087795 Enhancer 1.3 Ensembl ENCODE dbSUPER 9.3 +4.5 4507 4.2 PKNOX1 ATF1 ARNT NCOA2 TCF12 ZNF766 GATA2 E2F8 FOS ATF7 HTR1F CGGBP1 LOC105377198 PIR56827
GH03J087800 Enhancer 0.9 ENCODE dbSUPER 9.1 +8.2 8230 1.9 HDAC1 PKNOX1 ARNT TEAD4 TAL1 TCF12 CTBP1 GATA2 FOXK2 NCOR1 HTR1F CGGBP1 LOC105377198 PIR56827
GH03J088031 Enhancer 1 Ensembl ENCODE dbSUPER 4.5 +239.5 239509 2.2 SRF IRF2 AFF1 TFAP4 EBF1 ZBTB8A ZBTB40 ZNF518A YY1 FOXK2 GC03P088032 CGGBP1 HTR1F RNU6ATAC6P
GH03J088033 Enhancer 0.9 ENCODE dbSUPER 4.5 +241.5 241521 1.3 MEIS2 PKNOX1 TEAD4 TAL1 TCF12 POLR2A NCOR1 STAT2 ADNP CBFA2T2 GC03P088032 CGGBP1 HTR1F GC03P088045
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around HTR1F on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HTR1F gene promoter:
  • SEF-1 (1)
  • AML1a
  • C/EBPbeta
  • Sox5
  • CUTL1
  • Evi-1
  • Pbx1a
  • S8
  • Pax-2a
  • Pax-2

Genomic Locations for HTR1F Gene

Genomic Locations for HTR1F Gene
chr3:87,792,767-87,994,856
(GRCh38/hg38)
Size:
202,090 bases
Orientation:
Plus strand
chr3:88,031,726-88,042,919
(GRCh37/hg19)
Size:
11,194 bases
Orientation:
Plus strand

Genomic View for HTR1F Gene

Genes around HTR1F on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HTR1F Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HTR1F Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HTR1F Gene

Proteins for HTR1F Gene

  • Protein details for HTR1F Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P30939-5HT1F_HUMAN
    Recommended name:
    5-hydroxytryptamine receptor 1F
    Protein Accession:
    P30939

    Protein attributes for HTR1F Gene

    Size:
    366 amino acids
    Molecular mass:
    41709 Da
    Quaternary structure:
    No Data Available

neXtProt entry for HTR1F Gene

Post-translational modifications for HTR1F Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for HTR1F Gene

No data available for DME Specific Peptides for HTR1F Gene

Domains & Families for HTR1F Gene

Gene Families for HTR1F Gene

HGNC:
IUPHAR :
Human Protein Atlas (HPA):
  • FDA approved drug targets
  • G-protein coupled receptors
  • Predicted membrane proteins

Suggested Antigen Peptide Sequences for HTR1F Gene

Graphical View of Domain Structure for InterPro Entry

P30939

UniProtKB/Swiss-Prot:

5HT1F_HUMAN :
  • Belongs to the G-protein coupled receptor 1 family.
Family:
  • Belongs to the G-protein coupled receptor 1 family.
genes like me logo Genes that share domains with HTR1F: view

Function for HTR1F Gene

Molecular function for HTR1F Gene

UniProtKB/Swiss-Prot Function:
G-protein coupled receptor for 5-hydroxytryptamine (serotonin). Also functions as a receptor for various alkaloids and psychoactive substances. Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors, such as adenylate cyclase. Signaling inhibits adenylate cyclase activity.
GENATLAS Biochemistry:
5-hydroxytryptamine (serotonin) receptor,subtype 1F,G protein coupled receptor superfamily

Phenotypes From GWAS Catalog for HTR1F Gene

Gene Ontology (GO) - Molecular Function for HTR1F Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004930 G-protein coupled receptor activity IBA,IEA --
GO:0004993 G-protein coupled serotonin receptor activity IDA,IMP 21422162
GO:0030594 neurotransmitter receptor activity IBA --
GO:0051378 serotonin binding IDA 8380639
genes like me logo Genes that share ontologies with HTR1F: view
genes like me logo Genes that share phenotypes with HTR1F: view

Animal Models for HTR1F Gene

MGI Knock Outs for HTR1F:
  • Htr1f Htr1f<tm1.1(KOMP)Vlcg>
  • Htr1f Htr1f<tm1Dgen>

Animal Model Products

  • Taconic Biosciences Mouse Models for HTR1F

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for HTR1F

Clone Products

  • Addgene plasmids for HTR1F

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for HTR1F Gene

Localization for HTR1F Gene

Subcellular locations from UniProtKB/Swiss-Prot for HTR1F Gene

Cell membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HTR1F gene
Compartment Confidence
plasma membrane 5
extracellular 1
nucleus 1

Gene Ontology (GO) - Cellular Components for HTR1F Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane TAS,IMP 21422162
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0030425 dendrite IBA --
genes like me logo Genes that share ontologies with HTR1F: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for HTR1F Gene

Pathways & Interactions for HTR1F Gene

genes like me logo Genes that share pathways with HTR1F: view

Gene Ontology (GO) - Biological Process for HTR1F Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007165 signal transduction IEA --
GO:0007186 G-protein coupled receptor signaling pathway TAS --
GO:0007187 G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger TAS 8380639
GO:0007193 adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway IMP 21422162
GO:0007268 chemical synaptic transmission TAS 8380639
genes like me logo Genes that share ontologies with HTR1F: view

No data available for SIGNOR curated interactions for HTR1F Gene

Drugs & Compounds for HTR1F Gene

(49) Drugs for HTR1F Gene - From: DrugBank, ApexBio, DGIdb, IUPHAR, HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Sumatriptan Approved, Investigational Pharma Full agonist, Agonist, Antagonist, Partial agonist, agonist, Target 5-HT1 receptor agonist 123
Naratriptan Approved, Investigational Pharma Full agonist, Agonist, Partial agonist, agonist, Target 15
Rizatriptan Approved Pharma Full agonist, Agonist, Partial agonist, agonist, Target 35
Zolmitriptan Approved, Investigational Pharma Full agonist, Agonist, Partial agonist, agonist, Target Potent 5-HT1B/1D/1F agonist 21
Eletriptan Approved, Investigational Pharma Full agonist, Agonist, agonist, Target 19

(6) Additional Compounds for HTR1F Gene - From: IUPHAR, HMDB, and Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
10-OBn-7alpha-F-gingkolide B
Full agonist, Agonist
5-HT
Full agonist, Agonist, Inhibition, Inhibitor
alpha-methyl-5-HT
Full agonist, Agonist
LY573144
Full agonist, Agonist
N-Desmethyleletriptan
  • DETT CPD
  • N-Desmethyl eletriptan

(2) Tocris Compounds for HTR1F Gene

Compound Action Cas Number
LY 334370 hydrochloride Selective 5-HT1F agonist 199673-74-0
LY 344864 hydrochloride Potent, selective 5-HT1F agonist 1217756-94-9
genes like me logo Genes that share compounds with HTR1F: view

Transcripts for HTR1F Gene

mRNA/cDNA for HTR1F Gene

(6) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(10) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HTR1F Gene

5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for HTR1F

Clone Products

  • Addgene plasmids for HTR1F

Alternative Splicing Database (ASD) splice patterns (SP) for HTR1F Gene

No ASD Table

Relevant External Links for HTR1F Gene

GeneLoc Exon Structure for
HTR1F
ECgene alternative splicing isoforms for
HTR1F

Expression for HTR1F Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HTR1F Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for HTR1F Gene

This gene is overexpressed in Urinary Bladder (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for HTR1F Gene



Protein tissue co-expression partners for HTR1F Gene

NURSA nuclear receptor signaling pathways regulating expression of HTR1F Gene:

HTR1F

SOURCE GeneReport for Unigene cluster for HTR1F Gene:

Hs.248136

Evidence on tissue expression from TISSUES for HTR1F Gene

  • Nervous system(4.5)
genes like me logo Genes that share expression patterns with HTR1F: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for HTR1F Gene

Orthologs for HTR1F Gene

This gene was present in the common ancestor of animals.

Orthologs for HTR1F Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia HTR1F 34 33
  • 99.73 (n)
OneToOne
cow
(Bos Taurus)
Mammalia 5HTR1F 34
  • 95 (a)
OneToOne
HTR1F 33
  • 91.35 (n)
dog
(Canis familiaris)
Mammalia HTR1F 34 33
  • 92.17 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia HTR1F 34
  • 88 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Htr1f 16 34 33
  • 87.95 (n)
rat
(Rattus norvegicus)
Mammalia Htr1f 33
  • 87.21 (n)
chicken
(Gallus gallus)
Aves HTR1F 34 33
  • 79.06 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia HTR1F 34
  • 77 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia htr1f 33
  • 73.95 (n)
zebrafish
(Danio rerio)
Actinopterygii htr1fa 34 33
  • 62.94 (n)
OneToMany
htf1fb 34
  • 57 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta 5-HT1A 35
  • 43 (a)
5-HT1B 35
  • 42 (a)
5-HT7 35
  • 36 (a)
CG6989 35
  • 30 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta GPR5HT1B 33
  • 40.02 (n)
worm
(Caenorhabditis elegans)
Secernentea C09B7.1a 35
  • 33 (a)
C09B7.1b 35
  • 33 (a)
F14D12.6 35
  • 30 (a)
Species where no ortholog for HTR1F was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for HTR1F Gene

ENSEMBL:
Gene Tree for HTR1F (if available)
TreeFam:
Gene Tree for HTR1F (if available)
Aminode:
Evolutionary constrained regions (ECRs) for HTR1F: view image

Paralogs for HTR1F Gene

(17) SIMAP similar genes for HTR1F Gene using alignment to 2 proteins:

  • 5HT1F_HUMAN
  • Q9P2Q4_HUMAN
genes like me logo Genes that share paralogs with HTR1F: view

Variants for HTR1F Gene

Sequence variations from dbSNP and Humsavar for HTR1F Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1000019133 -- 87,942,757(+) G/C/T genic_upstream_transcript_variant, intron_variant
rs1000024090 -- 87,839,097(+) T/C genic_upstream_transcript_variant, intron_variant
rs1000026145 -- 87,908,320(+) T/G genic_upstream_transcript_variant, intron_variant
rs1000039922 -- 87,876,373(+) AAAGAAAATGTGAAAATGAAAAGAAAATGTG/AAAGAAAATGTG genic_upstream_transcript_variant, intron_variant
rs1000053512 -- 87,866,844(+) G/C genic_upstream_transcript_variant, intron_variant

Variation tolerance for HTR1F Gene

Residual Variation Intolerance Score: 17.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.86; 17.94% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HTR1F Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
HTR1F

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for HTR1F Gene

Disorders for HTR1F Gene

MalaCards: The human disease database

(1) MalaCards diseases for HTR1F Gene - From: DISEASES and Novoseek

Disorder Aliases PubMed IDs
migraine with or without aura 1
  • migraine with or without aura, susceptibility to, 1
- elite association - COSMIC cancer census association via MalaCards
Search HTR1F in MalaCards View complete list of genes associated with diseases

Additional Disease Information for HTR1F

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with HTR1F: view

No data available for UniProtKB/Swiss-Prot and Genatlas for HTR1F Gene

Publications for HTR1F Gene

  1. Cloning of another human serotonin receptor (5-HT1F): a fifth 5-HT1 receptor subtype coupled to the inhibition of adenylate cyclase. (PMID: 8380639) Adham N … Branchek TA (Proceedings of the National Academy of Sciences of the United States of America 1993) 2 3 4 22 58
  2. Molecular cloning and functional expression of 5-HT1E-like rat and human 5-hydroxytryptamine receptor genes. (PMID: 8384716) Lovenberg TW … Sutcliffe JG (Proceedings of the National Academy of Sciences of the United States of America 1993) 2 3 4 58
  3. Toward selective drug development for the human 5-hydroxytryptamine 1E receptor: a comparison of 5-hydroxytryptamine 1E and 1F receptor structure-affinity relationships. (PMID: 21422162) Klein MT … Teitler M (The Journal of pharmacology and experimental therapeutics 2011) 3 4 58
  4. Association study of the serotoninergic system in migraine in the Spanish population. (PMID: 19455600) Corominas R … Cormand B (American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 2010) 3 44 58
  5. Identification of new putative susceptibility genes for several psychiatric disorders by association analysis of regulatory and non-synonymous SNPs of 306 genes involved in neurotransmission and neurodevelopment. (PMID: 19086053) Gratacòs M … Psychiatric Genetics Network Group (American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 2009) 3 44 58

Products for HTR1F Gene

Sources for HTR1F Gene

Content
Loading form....