Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HSPA5 Gene

Aliases for HSPA5 Gene

  • Heat Shock Protein Family A (Hsp70) Member 5 2 3 5
  • Heat Shock 70kDa Protein 5 (Glucose-Regulated Protein, 78kDa) 2 3
  • Immunoglobulin Heavy Chain-Binding Protein 3 4
  • Heat Shock Protein 70 Family Protein 5 3 4
  • Heat Shock Protein Family A Member 5 3 4
  • Glucose-Regulated Protein, 78kDa 2 3
  • 78 KDa Glucose-Regulated Protein 3 4
  • Binding-Immunoglobulin Protein 3 4
  • HSP70 Family Protein 5 3 4
  • GRP78 3 4
  • Heat Shock 70kD Protein 5 (Glucose-Regulated Protein, 78kD) 2
  • Endoplasmic Reticulum Lumenal Ca(2+)-Binding Protein Grp78 3
  • Epididymis Secretory Sperm Binding Protein Li 89n 3
  • Endoplasmic Reticulum Chaperone BiP 3
  • EC 3.6.4.10 4
  • HEL-S-89n 3
  • GRP-78 4
  • MIF2 3
  • BIP 3
  • BiP 4

External Ids for HSPA5 Gene

Previous HGNC Symbols for HSPA5 Gene

  • GRP78

Previous GeneCards Identifiers for HSPA5 Gene

  • GC09M119111
  • GC09M119643
  • GC09M121450
  • GC09M123373
  • GC09M125076
  • GC09M127036
  • GC09M127997
  • GC09M097610

Summaries for HSPA5 Gene

Entrez Gene Summary for HSPA5 Gene

  • The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]

CIViC summary for HSPA5 Gene

GeneCards Summary for HSPA5 Gene

HSPA5 (Heat Shock Protein Family A (Hsp70) Member 5) is a Protein Coding gene. Diseases associated with HSPA5 include Borna Disease and Wolfram Syndrome 1. Among its related pathways are Protein processing in endoplasmic reticulum and Class I MHC mediated antigen processing and presentation. Gene Ontology (GO) annotations related to this gene include calcium ion binding and ubiquitin protein ligase binding. An important paralog of this gene is HSPA8.

UniProtKB/Swiss-Prot for HSPA5 Gene

  • Endoplasmic reticulum chaperone that plays a key role in protein folding and quality control in the endoplasmic reticulum lumen (PubMed:2294010, PubMed:23769672, PubMed:23990668, PubMed:28332555). Involved in the correct folding of proteins and degradation of misfolded proteins via its interaction with DNAJC10/ERdj5, probably to facilitate the release of DNAJC10/ERdj5 from its substrate (By similarity). Acts as a key repressor of the ERN1/IRE1-mediated unfolded protein response (UPR) (PubMed:1550958, PubMed:19538957). In the unstressed endoplasmic reticulum, recruited by DNAJB9/ERdj4 to the luminal region of ERN1/IRE1, leading to disrupt the dimerization of ERN1/IRE1, thereby inactivating ERN1/IRE1 (By similarity). Accumulation of misfolded protein in the endoplasmic reticulum causes release of HSPA5/BiP from ERN1/IRE1, allowing homodimerization and subsequent activation of ERN1/IRE1 (By similarity).

Gene Wiki entry for HSPA5 Gene

Additional gene information for HSPA5 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HSPA5 Gene

Genomics for HSPA5 Gene

GeneHancer (GH) Regulatory Elements for HSPA5 Gene

Promoters and enhancers for HSPA5 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09J125238 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 650.7 0.0 -49 6.6 PKNOX1 CLOCK SMAD1 ZFP64 ARID4B NEUROD1 SIN3A DMAP1 ZNF2 YY1 GAPVD1 ENSG00000239705 HSPA5 GC09M125241 GOLGA1 PRPS1P2 LOC100419284 ENSG00000231149 RABEPK RPL35
GH09J125630 Enhancer 2.3 VISTA UCNEbase FANTOM5 Ensembl ENCODE dbSUPER 2 -391.5 -391541 4.1 HDGF PKNOX1 SMAD1 ARID4B FEZF1 YBX1 IRF4 TCF12 ARID2 ZNF207 GAPVD1 GOLGA1 PRPS1P2 PBX3 HSPA5 PPP6C HNRNPA1P15 MAPKAP1
GH09J125659 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 1.2 -418.6 -418600 1.5 PKNOX1 STAT5A EBF1 BATF IRF4 RELA NFATC1 EED ATF7 FOS RNU6-1020P GAPVD1 HSPA5 MAPKAP1 HNRNPA1P15
GH09J125233 Enhancer 0.9 ENCODE dbSUPER 0.4 +7.3 7256 2.1 IRF2 SMAD1 JUN ZNF384 FOSL1 CCNT2 POLR2A NFATC1 RBM22 PRDM10 RABEPK SCAI MIR181A2HG PRPS1P2 HSPA5 GC09M125241
GH09J125236 Enhancer 0.5 dbSUPER 0.7 +4.6 4567 1.3 CTCF SMAD5 ZBED1 RBM22 ZNF384 PRDM4 GC09M125241 HSPA5 RABEPK
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around HSPA5 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HSPA5 gene promoter:
  • CREB
  • c-Jun
  • deltaCREB
  • ATF-2
  • AP-1
  • c-Myb

Genomic Locations for HSPA5 Gene

Genomic Locations for HSPA5 Gene
chr9:125,234,848-125,241,387
(GRCh38/hg38)
Size:
6,540 bases
Orientation:
Minus strand
chr9:127,997,127-128,003,666
(GRCh37/hg19)
Size:
6,540 bases
Orientation:
Minus strand

Genomic View for HSPA5 Gene

Genes around HSPA5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HSPA5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HSPA5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HSPA5 Gene

Proteins for HSPA5 Gene

  • Protein details for HSPA5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P11021-BIP_HUMAN
    Recommended name:
    Endoplasmic reticulum chaperone BiP
    Protein Accession:
    P11021
    Secondary Accessions:
    • B0QZ61
    • Q2EF78
    • Q9NPF1
    • Q9UK02

    Protein attributes for HSPA5 Gene

    Size:
    654 amino acids
    Molecular mass:
    72333 Da
    Quaternary structure:
    • Monomer and homooligomer; homooligomerization via the interdomain linker inactivates the chaperone activity and acts as a storage of HSPA5/BiP molecules (By similarity). Interacts with DNAJC1 (via J domain) (By similarity). Component of an EIF2 complex at least composed of CELF1/CUGBP1, CALR, CALR3, EIF2S1, EIF2S2, HSP90B1 and HSPA5 (By similarity). Part of a large chaperone multiprotein complex comprising DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PDIA6, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX (By similarity). Interacts with TMEM132A and TRIM21 (PubMed:12699405). May form a complex with ERLEC1, OS9, SEL1L and SYVN1 (PubMed:18264092,PubMed:18502753). Interacts with DNAJC10 (PubMed:12411443, PubMed:23769672). Interacts with DNAJB9/ERdj4; leading to recruit HSPA5/BiP to ERN1/IRE1 (By similarity). Interacts with ERN1/IRE1; interaction takes place following interaction with DNAJB9/ERdj4 and leads to inactivate ERN1/IRE1 (By similarity). Interacts with MX1 (By similarity). Interacts with METTL23 (PubMed:23349634). Interacts with CEMIP; the interaction induces calcium leakage from the endoplasmic reticulum and cell migration (PubMed:23990668). Interacts with PCSK4 form; the interaction takes place in the endoplasmic reticulum (PubMed:21080038). Interacts with CIPC (PubMed:26657846). Interacts with CCDC88B (via C-terminus); the interaction opposes ERN1-mediated JNK activation, protecting against apoptosis (PubMed:21289099). Interacts with INPP5K; necessary for INPP5K localization at the endoplasmic reticulum (PubMed:26940976). Interacts with MANF; the interaction is direct (PubMed:22637475). Interacts with LOXL2; leading to activate the ERN1/IRE1-XBP1 pathway of the unfolded protein response (PubMed:28332555).

    Three dimensional structures from OCA and Proteopedia for HSPA5 Gene

neXtProt entry for HSPA5 Gene

Post-translational modifications for HSPA5 Gene

  • AMPylated by FICD (PubMed:25601083). In unstressed cells, AMPylation at Thr-518 by FICD inactivates the chaperome activity: AMPylated form is locked in a relatively inert state and only weakly stimulated by J domain-containing proteins (By similarity). In response to endoplasmic reticulum stress, de-AMPylation by the same protein, FICD, restores the chaperone activity (By similarity).
  • Glycosylation at Thr643, isoforms=203, and Thr69
  • Ubiquitination at Lys601, Lys573, isoforms=547, isoforms=523, isoforms=376, isoforms=370, Lys326, Lys268, isoforms=118, isoforms=113, and Lys96
  • Modification sites at PhosphoSitePlus

Other Protein References for HSPA5 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for HSPA5 Gene

Domains & Families for HSPA5 Gene

Gene Families for HSPA5 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted secreted proteins

Protein Domains for HSPA5 Gene

Suggested Antigen Peptide Sequences for HSPA5 Gene

Graphical View of Domain Structure for InterPro Entry

P11021

UniProtKB/Swiss-Prot:

BIP_HUMAN :
  • The interdomain linker regulates the chaperone activity by mediating the formation of homooligomers. Homooligomers are formed by engagement of the interdomain linker of one HSPA5/BiP molecule as a typical substrate of an adjacent HSPA5/BiP molecule. HSPA5/BiP oligomerization inactivates participating HSPA5/BiP protomers. HSPA5/BiP oligomers probably act as reservoirs to store HSPA5/BiP molecules when they are not needed by the cell. When the levels of unfolded proteins rise, cells can rapidly break up these oligomers to make active monomers.
  • Belongs to the heat shock protein 70 family.
Domain:
  • The interdomain linker regulates the chaperone activity by mediating the formation of homooligomers. Homooligomers are formed by engagement of the interdomain linker of one HSPA5/BiP molecule as a typical substrate of an adjacent HSPA5/BiP molecule. HSPA5/BiP oligomerization inactivates participating HSPA5/BiP protomers. HSPA5/BiP oligomers probably act as reservoirs to store HSPA5/BiP molecules when they are not needed by the cell. When the levels of unfolded proteins rise, cells can rapidly break up these oligomers to make active monomers.
Family:
  • Belongs to the heat shock protein 70 family.
genes like me logo Genes that share domains with HSPA5: view

Function for HSPA5 Gene

Molecular function for HSPA5 Gene

UniProtKB/Swiss-Prot Function:
Endoplasmic reticulum chaperone that plays a key role in protein folding and quality control in the endoplasmic reticulum lumen (PubMed:2294010, PubMed:23769672, PubMed:23990668, PubMed:28332555). Involved in the correct folding of proteins and degradation of misfolded proteins via its interaction with DNAJC10/ERdj5, probably to facilitate the release of DNAJC10/ERdj5 from its substrate (By similarity). Acts as a key repressor of the ERN1/IRE1-mediated unfolded protein response (UPR) (PubMed:1550958, PubMed:19538957). In the unstressed endoplasmic reticulum, recruited by DNAJB9/ERdj4 to the luminal region of ERN1/IRE1, leading to disrupt the dimerization of ERN1/IRE1, thereby inactivating ERN1/IRE1 (By similarity). Accumulation of misfolded protein in the endoplasmic reticulum causes release of HSPA5/BiP from ERN1/IRE1, allowing homodimerization and subsequent activation of ERN1/IRE1 (By similarity).
UniProtKB/Swiss-Prot CatalyticActivity:
ATP + H(2)O = ADP + phosphate.
UniProtKB/Swiss-Prot EnzymeRegulation:
The chaperone activity is regulated by ATP-induced allosteric coupling of the nucleotide-binding (NBD) and substrate-binding (SBD) domains. In the ADP-bound and nucleotide-free (apo) states, the two domains have little interaction (PubMed:26655470). In contrast, in the ATP-bound state the two domains are tightly coupled, which results in drastically accelerated kinetics in both binding and release of polypeptide substrates (PubMed:26655470). J domain-containing co-chaperones (DNAJB9/ERdj4 or DNAJC10/ERdj5) stimulate the ATPase activity and are required for efficient substrate recognition by HSPA5/BiP (By similarity). Homooligomerization inactivates participating HSPA5/BiP protomers and probably act as reservoirs to store HSPA5/BiP molecules when they are not needed by the cell (By similarity).
UniProtKB/Swiss-Prot Induction:
By endoplasmic reticulum stress.
GENATLAS Biochemistry:
glucose regulated protein (78kDa),HSP70 homolog,in the endoplasmic reticulum,subunit of PPP1CC2

Enzyme Numbers (IUBMB) for HSPA5 Gene

Gene Ontology (GO) - Molecular Function for HSPA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding TAS 16130169
GO:0005515 protein binding IPI 11907036
GO:0005524 ATP binding IEA --
GO:0016787 hydrolase activity IEA --
GO:0016887 ATPase activity ISS,IDA --
genes like me logo Genes that share ontologies with HSPA5: view
genes like me logo Genes that share phenotypes with HSPA5: view

Animal Models for HSPA5 Gene

MGI Knock Outs for HSPA5:
  • Hspa5 Hspa5<tm1.1(KOMP)Vlcg>
  • Hspa5 Hspa5<tm1.1Alee>

Animal Model Products

Clone Products

  • Addgene plasmids for HSPA5

No data available for Phenotypes From GWAS Catalog , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for HSPA5 Gene

Localization for HSPA5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for HSPA5 Gene

Endoplasmic reticulum lumen. Melanosome. Cytoplasm. Note=Identified by mass spectrometry in melanosome fractions from stage I to stage IV. {ECO:0000269 PubMed:12643545}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HSPA5 gene
Compartment Confidence
extracellular 5
nucleus 5
endoplasmic reticulum 5
mitochondrion 4
cytosol 4
plasma membrane 3
cytoskeleton 2
lysosome 2
golgi apparatus 2
peroxisome 1
endosome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for HSPA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IMP 11943137
GO:0005737 cytoplasm IEA,IBA --
GO:0005739 mitochondrion IEA --
GO:0005783 endoplasmic reticulum IDA,TAS 16130169
GO:0005788 endoplasmic reticulum lumen TAS --
genes like me logo Genes that share ontologies with HSPA5: view

Pathways & Interactions for HSPA5 Gene

genes like me logo Genes that share pathways with HSPA5: view

Gene Ontology (GO) - Biological Process for HSPA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006983 ER overload response IEA --
GO:0006986 response to unfolded protein IBA --
GO:0006987 obsolete activation of signaling protein activity involved in unfolded protein response IEA --
GO:0009314 response to radiation IEA --
GO:0010976 positive regulation of neuron projection development IEA --
genes like me logo Genes that share ontologies with HSPA5: view

No data available for SIGNOR curated interactions for HSPA5 Gene

Drugs & Compounds for HSPA5 Gene

(57) Drugs for HSPA5 Gene - From: DrugBank, PharmGKB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Copper Approved, Investigational Pharma Target 202
Antihemophilic factor, human recombinant Approved, Investigational Pharma Target, chaperone 0
Aspirin Approved, Vet_approved Pharma Channel blocker, Target, binding 1232
Lonoctocog alfa Approved, Investigational Pharma Target, chaperone 0
Moroctocog alfa Approved Pharma Target, chaperone 0

(46) Additional Compounds for HSPA5 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with HSPA5: view

Transcripts for HSPA5 Gene

mRNA/cDNA for HSPA5 Gene

(1) REFSEQ mRNAs :
(7) Additional mRNA sequences :
(1367) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HSPA5 Gene

Heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa):
Representative Sequences:

Clone Products

  • Addgene plasmids for HSPA5

Alternative Splicing Database (ASD) splice patterns (SP) for HSPA5 Gene

No ASD Table

Relevant External Links for HSPA5 Gene

GeneLoc Exon Structure for
HSPA5
ECgene alternative splicing isoforms for
HSPA5

Expression for HSPA5 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HSPA5 Gene

Protein differential expression in normal tissues from HIPED for HSPA5 Gene

This gene is overexpressed in Bone marrow stromal cell (6.9) and Lymph node (6.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for HSPA5 Gene



Protein tissue co-expression partners for HSPA5 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of HSPA5 Gene:

HSPA5

SOURCE GeneReport for Unigene cluster for HSPA5 Gene:

Hs.743241

Evidence on tissue expression from TISSUES for HSPA5 Gene

  • Nervous system(4.9)
  • Liver(4.8)
  • Muscle(4.6)
  • Intestine(4.3)
  • Pancreas(4.2)
  • Lung(4.1)
  • Heart(3.8)
  • Thyroid gland(3.8)
  • Eye(3.4)
  • Kidney(3.4)
  • Blood(3.1)
  • Bone(3.1)
  • Skin(3)
  • Stomach(3)
  • Spleen(2.9)
  • Adrenal gland(2.8)
  • Bone marrow(2.8)
  • Lymph node(2.6)
genes like me logo Genes that share expression patterns with HSPA5: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for HSPA5 Gene

Orthologs for HSPA5 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for HSPA5 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia HSPA5 34 33
  • 99.69 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia HSPA5 34
  • 96 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia HSPA5 34
  • 96 (a)
OneToOne
dog
(Canis familiaris)
Mammalia HSPA5 34 33
  • 94.09 (n)
OneToOne
cow
(Bos Taurus)
Mammalia HSPA5 33
  • 94.05 (n)
mouse
(Mus musculus)
Mammalia Hspa5 16 34 33
  • 92.35 (n)
rat
(Rattus norvegicus)
Mammalia Hspa5 33
  • 91.03 (n)
chicken
(Gallus gallus)
Aves HSPA5 34 33
  • 84.59 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia HSPA5 34
  • 94 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100492570 33
  • 80.91 (n)
Str.3462 33
African clawed frog
(Xenopus laevis)
Amphibia hspa5-prov 33
zebrafish
(Danio rerio)
Actinopterygii hspa5 34 33
  • 77.55 (n)
OneToOne
Dr.26116 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.11216 33
fruit fly
(Drosophila melanogaster)
Insecta Hsc70-3 34 33
  • 73.49 (n)
OneToOne
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004192 33
  • 71.81 (n)
worm
(Caenorhabditis elegans)
Secernentea hsp-4 34
  • 75 (a)
OneToMany
hsp-3 34 33
  • 71.02 (n)
OneToMany
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0D09559g 33
  • 64.93 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes KAR2 36 33
  • 64.59 (n)
SSA2 34
  • 64 (a)
OneToMany
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ACR038W 33
  • 62.97 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons BIP1 33
  • 64.91 (n)
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.4801 33
soybean
(Glycine max)
eudicotyledons Gma.17631 33
rice
(Oryza sativa)
Liliopsida Os02g0115900 33
  • 66.13 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 79 (a)
OneToOne
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes bip1 33
  • 66.83 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU03982 33
  • 65.76 (n)
Species where no ortholog for HSPA5 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for HSPA5 Gene

ENSEMBL:
Gene Tree for HSPA5 (if available)
TreeFam:
Gene Tree for HSPA5 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for HSPA5: view image

Paralogs for HSPA5 Gene

Paralogs for HSPA5 Gene

(14) SIMAP similar genes for HSPA5 Gene using alignment to 1 proteins:

  • GRP78_HUMAN

Pseudogenes.org Pseudogenes for HSPA5 Gene

genes like me logo Genes that share paralogs with HSPA5: view

Variants for HSPA5 Gene

Sequence variations from dbSNP and Humsavar for HSPA5 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs1000089203 -- 125,242,018(-) T/C upstream_transcript_variant
rs1000192312 -- 125,241,627(-) C/G upstream_transcript_variant
rs1001027372 -- 125,235,962(-) TGGATT/T 3_prime_UTR_variant
rs1001147608 -- 125,243,149(-) G/A upstream_transcript_variant
rs1001276387 -- 125,234,659(-) TATATATGTATACATAAACACATATATATGTATACATA/TATATATGTATACATA downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for HSPA5 Gene

Variant ID Type Subtype PubMed ID
nsv982345 CNV duplication 23825009

Variation tolerance for HSPA5 Gene

Residual Variation Intolerance Score: 14.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.09; 22.11% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HSPA5 Gene

Human Gene Mutation Database (HGMD)
HSPA5
SNPedia medical, phenotypic, and genealogical associations of SNPs for
HSPA5

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HSPA5 Gene

Disorders for HSPA5 Gene

MalaCards: The human disease database

(12) MalaCards diseases for HSPA5 Gene - From: HGMD, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
borna disease
  • enzootic encephalomyelitis
wolfram syndrome 1
  • wfs1
wolfram syndrome
  • wfs
halothane hepatitis
  • hepatitis halothane
short-rib thoracic dysplasia 2 with or without polydactyly
  • srtd2
- elite association - COSMIC cancer census association via MalaCards
Search HSPA5 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

BIP_HUMAN
  • Note=Autoantigen in rheumatoid arthritis. {ECO:0000269 PubMed:11160188}.

Additional Disease Information for HSPA5

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with HSPA5: view

No data available for Genatlas for HSPA5 Gene

Publications for HSPA5 Gene

  1. A novel link between Fic (filamentation induced by cAMP)-mediated adenylylation/AMPylation and the unfolded protein response. (PMID: 25601083) Sanyal A … Mattoo S (The Journal of biological chemistry 2015) 3 4 58
  2. A newly uncovered group of distantly related lysine methyltransferases preferentially interact with molecular chaperones to regulate their activity. (PMID: 23349634) Cloutier P … Coulombe B (PLoS genetics 2013) 3 4 58
  3. Identification and characterization of a novel human methyltransferase modulating Hsp70 protein function through lysine methylation. (PMID: 23921388) Jakobsson ME … Falnes PØ (The Journal of biological chemistry 2013) 3 4 58
  4. Unraveling the role of KIAA1199, a novel endoplasmic reticulum protein, in cancer cell migration. (PMID: 23990668) Evensen NA … Cao J (Journal of the National Cancer Institute 2013) 3 4 58
  5. ERdj5 is the ER reductase that catalyzes the removal of non-native disulfides and correct folding of the LDL receptor. (PMID: 23769672) Oka OB … Bulleid NJ (Molecular cell 2013) 3 4 58

Products for HSPA5 Gene

  • Addgene plasmids for HSPA5

Sources for HSPA5 Gene

Content
Loading form....