The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010] See more...

Aliases for HSPA5 Gene

Aliases for HSPA5 Gene

  • Heat Shock Protein Family A (Hsp70) Member 5 2 3 5
  • Heat Shock 70kDa Protein 5 (Glucose-Regulated Protein, 78kDa) 2 3
  • Immunoglobulin Heavy Chain-Binding Protein 3 4
  • Heat Shock Protein 70 Family Protein 5 3 4
  • Heat Shock Protein Family A Member 5 3 4
  • Endoplasmic Reticulum Chaperone BiP 3 4
  • Glucose-Regulated Protein, 78kDa 2 3
  • 78 KDa Glucose-Regulated Protein 3 4
  • Binding-Immunoglobulin Protein 3 4
  • HSP70 Family Protein 5 3 4
  • GRP78 3 4
  • Heat Shock 70kD Protein 5 (Glucose-Regulated Protein, 78kD) 2
  • Endoplasmic Reticulum Lumenal Ca(2+)-Binding Protein Grp78 3
  • Epididymis Secretory Sperm Binding Protein Li 89n 3
  • EC 4
  • HEL-S-89n 3
  • GRP-78 4
  • MIF2 3
  • BIP 3
  • BiP 4

External Ids for HSPA5 Gene

Previous HGNC Symbols for HSPA5 Gene

  • GRP78

Previous GeneCards Identifiers for HSPA5 Gene

  • GC09M119111
  • GC09M119643
  • GC09M121450
  • GC09M123373
  • GC09M125076
  • GC09M127036
  • GC09M127997
  • GC09M097610

Summaries for HSPA5 Gene

Entrez Gene Summary for HSPA5 Gene

  • The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]

CIViC Summary for HSPA5 Gene

GeneCards Summary for HSPA5 Gene

HSPA5 (Heat Shock Protein Family A (Hsp70) Member 5) is a Protein Coding gene. Diseases associated with HSPA5 include Mucormycosis and Wolfram Syndrome 1. Among its related pathways are Cellular Senescence (REACTOME) and Photodynamic therapy-induced unfolded protein response. Gene Ontology (GO) annotations related to this gene include calcium ion binding and ubiquitin protein ligase binding. An important paralog of this gene is HSPA8.

UniProtKB/Swiss-Prot Summary for HSPA5 Gene

  • Endoplasmic reticulum chaperone that plays a key role in protein folding and quality control in the endoplasmic reticulum lumen (PubMed:2294010, PubMed:23769672, PubMed:23990668, PubMed:28332555). Involved in the correct folding of proteins and degradation of misfolded proteins via its interaction with DNAJC10/ERdj5, probably to facilitate the release of DNAJC10/ERdj5 from its substrate (By similarity). Acts as a key repressor of the ERN1/IRE1-mediated unfolded protein response (UPR) (PubMed:1550958, PubMed:19538957). In the unstressed endoplasmic reticulum, recruited by DNAJB9/ERdj4 to the luminal region of ERN1/IRE1, leading to disrupt the dimerization of ERN1/IRE1, thereby inactivating ERN1/IRE1 (By similarity). Accumulation of misfolded protein in the endoplasmic reticulum causes release of HSPA5/BiP from ERN1/IRE1, allowing homodimerization and subsequent activation of ERN1/IRE1 (By similarity). Plays an auxiliary role in post-translational transport of small presecretory proteins across endoplasmic reticulum (ER). May function as an allosteric modulator for SEC61 channel-forming translocon complex, likely cooperating with SEC62 to enable the productive insertion of these precursors into SEC61 channel. Appears to specifically regulate translocation of precursors having inhibitory residues in their mature region that weaken channel gating.

Gene Wiki entry for HSPA5 Gene

Additional gene information for HSPA5 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for HSPA5 Gene

Genomics for HSPA5 Gene

GeneHancer (GH) Regulatory Elements for HSPA5 Gene

Promoters and enhancers for HSPA5 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around HSPA5 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HSPA5 gene promoter:
  • AP-1
  • ATF-2
  • c-Jun
  • c-Myb
  • CREB
  • deltaCREB

Genomic Locations for HSPA5 Gene

Genomic Locations for HSPA5 Gene
6,540 bases
Minus strand
6,540 bases
Minus strand

Genomic View for HSPA5 Gene

Genes around HSPA5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HSPA5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HSPA5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HSPA5 Gene

Proteins for HSPA5 Gene

  • Protein details for HSPA5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Endoplasmic reticulum chaperone BiP
    Protein Accession:
    Secondary Accessions:
    • B0QZ61
    • Q2EF78
    • Q9NPF1
    • Q9UK02

    Protein attributes for HSPA5 Gene

    654 amino acids
    Molecular mass:
    72333 Da
    Quaternary structure:
    • Monomer and homooligomer; homooligomerization via the interdomain linker inactivates the chaperone activity and acts as a storage of HSPA5/BiP molecules (By similarity). Interacts with DNAJC1 (via J domain) (By similarity). Component of an EIF2 complex at least composed of CELF1/CUGBP1, CALR, CALR3, EIF2S1, EIF2S2, HSP90B1 and HSPA5 (By similarity). Part of a large chaperone multiprotein complex comprising DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PDIA6, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX (By similarity). Interacts with TMEM132A and TRIM21 (PubMed:12699405). May form a complex with ERLEC1, OS9, SEL1L and SYVN1 (PubMed:18264092,PubMed:18502753). Interacts with DNAJC10 (PubMed:12411443, PubMed:23769672). Interacts with DNAJB9/ERdj4; leading to recruit HSPA5/BiP to ERN1/IRE1 (By similarity). Interacts with ERN1/IRE1; interaction takes place following interaction with DNAJB9/ERdj4 and leads to inactivate ERN1/IRE1 (By similarity). Interacts with MX1 (By similarity). Interacts with METTL23 (PubMed:23349634). Interacts with CEMIP; the interaction induces calcium leakage from the endoplasmic reticulum and cell migration (PubMed:23990668). Interacts with PCSK4 form; the interaction takes place in the endoplasmic reticulum (PubMed:21080038). Interacts with CIPC (PubMed:26657846). Interacts with CCDC88B (via C-terminus); the interaction opposes ERN1-mediated JNK activation, protecting against apoptosis (PubMed:21289099). Interacts with INPP5K; necessary for INPP5K localization at the endoplasmic reticulum (PubMed:26940976). Interacts with MANF; the interaction is direct (PubMed:22637475). Interacts with LOXL2; leading to activate the ERN1/IRE1-XBP1 pathway of the unfolded protein response (PubMed:28332555). Interacts with CLU under stressed condition; interaction increases CLU protein stability; facilitates its retrotranslocation and redistribution to the mitochondria; cooperatively suppress stress-induced apoptosis by stabilizing mitochondrial membrane integrity (PubMed:22689054). Interacts with CCDC47 (By similarity).

    Three dimensional structures from OCA and Proteopedia for HSPA5 Gene

neXtProt entry for HSPA5 Gene

Post-translational modifications for HSPA5 Gene

  • AMPylated by FICD (PubMed:25601083). In unstressed cells, AMPylation at Thr-518 by FICD inactivates the chaperome activity: AMPylated form is locked in a relatively inert state and only weakly stimulated by J domain-containing proteins (By similarity). In response to endoplasmic reticulum stress, de-AMPylation by the same protein, FICD, restores the chaperone activity (By similarity).
  • Glycosylation at Thr69, Thr203, and Thr643
  • Ubiquitination at Lys96, Lys113, Lys118, Lys213, Lys268, Lys326, Lys370, Lys376, Lys523, Lys547, Lys573, and Lys601
  • Modification sites at PhosphoSitePlus

Other Protein References for HSPA5 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for HSPA5 Gene

Domains & Families for HSPA5 Gene

Gene Families for HSPA5 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted secreted proteins

Protein Domains for HSPA5 Gene

Suggested Antigen Peptide Sequences for HSPA5 Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ60062, highly similar to 78 kDa glucose-regulated protein (B4DEF7_HUMAN)
  • Immunoglobulin heavy chain-binding protein (GRP78_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • The interdomain linker regulates the chaperone activity by mediating the formation of homooligomers. Homooligomers are formed by engagement of the interdomain linker of one HSPA5/BiP molecule as a typical substrate of an adjacent HSPA5/BiP molecule. HSPA5/BiP oligomerization inactivates participating HSPA5/BiP protomers. HSPA5/BiP oligomers probably act as reservoirs to store HSPA5/BiP molecules when they are not needed by the cell. When the levels of unfolded proteins rise, cells can rapidly break up these oligomers to make active monomers.
  • Belongs to the heat shock protein 70 family.
  • The interdomain linker regulates the chaperone activity by mediating the formation of homooligomers. Homooligomers are formed by engagement of the interdomain linker of one HSPA5/BiP molecule as a typical substrate of an adjacent HSPA5/BiP molecule. HSPA5/BiP oligomerization inactivates participating HSPA5/BiP protomers. HSPA5/BiP oligomers probably act as reservoirs to store HSPA5/BiP molecules when they are not needed by the cell. When the levels of unfolded proteins rise, cells can rapidly break up these oligomers to make active monomers.
  • Belongs to the heat shock protein 70 family.
genes like me logo Genes that share domains with HSPA5: view

Function for HSPA5 Gene

Molecular function for HSPA5 Gene

UniProtKB/Swiss-Prot Function:
Endoplasmic reticulum chaperone that plays a key role in protein folding and quality control in the endoplasmic reticulum lumen (PubMed:2294010, PubMed:23769672, PubMed:23990668, PubMed:28332555). Involved in the correct folding of proteins and degradation of misfolded proteins via its interaction with DNAJC10/ERdj5, probably to facilitate the release of DNAJC10/ERdj5 from its substrate (By similarity). Acts as a key repressor of the ERN1/IRE1-mediated unfolded protein response (UPR) (PubMed:1550958, PubMed:19538957). In the unstressed endoplasmic reticulum, recruited by DNAJB9/ERdj4 to the luminal region of ERN1/IRE1, leading to disrupt the dimerization of ERN1/IRE1, thereby inactivating ERN1/IRE1 (By similarity). Accumulation of misfolded protein in the endoplasmic reticulum causes release of HSPA5/BiP from ERN1/IRE1, allowing homodimerization and subsequent activation of ERN1/IRE1 (By similarity). Plays an auxiliary role in post-translational transport of small presecretory proteins across endoplasmic reticulum (ER). May function as an allosteric modulator for SEC61 channel-forming translocon complex, likely cooperating with SEC62 to enable the productive insertion of these precursors into SEC61 channel. Appears to specifically regulate translocation of precursors having inhibitory residues in their mature region that weaken channel gating.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=ATP + H2O = ADP + H(+) + phosphate; Xref=Rhea:RHEA:13065, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:30616, ChEBI:CHEBI:43474, ChEBI:CHEBI:456216; EC=; Evidence=. ;.
UniProtKB/Swiss-Prot EnzymeRegulation:
The chaperone activity is regulated by ATP-induced allosteric coupling of the nucleotide-binding (NBD) and substrate-binding (SBD) domains. In the ADP-bound and nucleotide-free (apo) states, the two domains have little interaction (PubMed:26655470). In contrast, in the ATP-bound state the two domains are tightly coupled, which results in drastically accelerated kinetics in both binding and release of polypeptide substrates (PubMed:26655470). J domain-containing co-chaperones (DNAJB9/ERdj4 or DNAJC10/ERdj5) stimulate the ATPase activity and are required for efficient substrate recognition by HSPA5/BiP (By similarity). Homooligomerization inactivates participating HSPA5/BiP protomers and probably act as reservoirs to store HSPA5/BiP molecules when they are not needed by the cell (By similarity).
UniProtKB/Swiss-Prot Induction:
By endoplasmic reticulum stress.
GENATLAS Biochemistry:
glucose regulated protein (78kDa),HSP70 homolog,in the endoplasmic reticulum,subunit of PPP1CC2

Enzyme Numbers (IUBMB) for HSPA5 Gene

Gene Ontology (GO) - Molecular Function for HSPA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding TAS 16130169
GO:0005515 protein binding IPI 11907036
GO:0005524 ATP binding IBA 21873635
GO:0016787 hydrolase activity IEA --
GO:0016887 ATPase activity ISS,IDA --
genes like me logo Genes that share ontologies with HSPA5: view
genes like me logo Genes that share phenotypes with HSPA5: view

Animal Models for HSPA5 Gene

MGI Knock Outs for HSPA5:
  • Hspa5 Hspa5<tm1.1(KOMP)Vlcg>
  • Hspa5 Hspa5<tm1.1Alee>

Animal Model Products

CRISPR Products

Clone Products

  • Addgene plasmids for HSPA5

No data available for Phenotypes From GWAS Catalog , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for HSPA5 Gene

Localization for HSPA5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for HSPA5 Gene

Endoplasmic reticulum lumen. Melanosome. Cytoplasm. Note=Identified by mass spectrometry in melanosome fractions from stage I to stage IV. {ECO:0000269 PubMed:12643545}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HSPA5 gene
Compartment Confidence
mitochondrion 5
endoplasmic reticulum 5
cytosol 5
nucleus 4
plasma membrane 3
extracellular 2
cytoskeleton 2
endosome 1
lysosome 1
golgi apparatus 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for HSPA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IMP,IBA 11943137
GO:0005737 cytoplasm IDA,IBA 22689054
GO:0005739 mitochondrion IDA,IEA 22689054
GO:0005783 endoplasmic reticulum TAS,IDA 16130169
GO:0005788 endoplasmic reticulum lumen TAS,IBA --
genes like me logo Genes that share ontologies with HSPA5: view

Pathways & Interactions for HSPA5 Gene

genes like me logo Genes that share pathways with HSPA5: view

SIGNOR curated interactions for HSPA5 Gene

Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for HSPA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001554 luteolysis IEA --
GO:0006983 ER overload response IEA --
GO:0006986 response to unfolded protein IBA 21873635
GO:0009314 response to radiation IEA --
GO:0010976 positive regulation of neuron projection development IEA --
genes like me logo Genes that share ontologies with HSPA5: view

Drugs & Compounds for HSPA5 Gene

(59) Drugs for HSPA5 Gene - From: DrugBank, PharmGKB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Copper Approved, Investigational Pharma Target 227
Antihemophilic factor, human recombinant Approved, Investigational Pharma Target, chaperone 0
Aspirin Approved, Vet_approved Pharma Channel blocker, Target, binding 1403
Lonoctocog alfa Approved, Investigational Pharma Target, chaperone 0
Moroctocog alfa Approved Pharma Target, chaperone 0

(44) Additional Compounds for HSPA5 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with HSPA5: view

Transcripts for HSPA5 Gene

mRNA/cDNA for HSPA5 Gene

(1) REFSEQ mRNAs :
(10) Additional mRNA sequences :
(1367) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

  • Addgene plasmids for HSPA5

Alternative Splicing Database (ASD) splice patterns (SP) for HSPA5 Gene

No ASD Table

Relevant External Links for HSPA5 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for HSPA5 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HSPA5 Gene

Protein differential expression in normal tissues from HIPED for HSPA5 Gene

This gene is overexpressed in Bone marrow stromal cell (6.9) and Lymph node (6.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for HSPA5 Gene

Protein tissue co-expression partners for HSPA5 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of HSPA5 Gene:


SOURCE GeneReport for Unigene cluster for HSPA5 Gene:


Evidence on tissue expression from TISSUES for HSPA5 Gene

  • Nervous system(4.9)
  • Liver(4.8)
  • Muscle(4.6)
  • Intestine(4.3)
  • Pancreas(4.2)
  • Lung(4.1)
  • Heart(3.8)
  • Thyroid gland(3.8)
  • Eye(3.4)
  • Kidney(3.4)
  • Blood(3.1)
  • Bone(3.1)
  • Skin(3)
  • Stomach(3)
  • Spleen(2.9)
  • Adrenal gland(2.8)
  • Bone marrow(2.8)
  • Lymph node(2.6)
genes like me logo Genes that share expression patterns with HSPA5: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for HSPA5 Gene

Orthologs for HSPA5 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for HSPA5 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia HSPA5 33 32
  • 99.69 (n)
(Ornithorhynchus anatinus)
Mammalia HSPA5 33
  • 96 (a)
(Monodelphis domestica)
Mammalia HSPA5 33
  • 96 (a)
(Canis familiaris)
Mammalia HSPA5 33 32
  • 94.09 (n)
(Bos Taurus)
Mammalia HSPA5 32
  • 94.05 (n)
(Mus musculus)
Mammalia Hspa5 17 33 32
  • 92.35 (n)
(Rattus norvegicus)
Mammalia Hspa5 32
  • 91.03 (n)
(Gallus gallus)
Aves HSPA5 33 32
  • 84.59 (n)
(Anolis carolinensis)
Reptilia HSPA5 33
  • 94 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100492570 32
  • 80.91 (n)
Str.3462 32
African clawed frog
(Xenopus laevis)
Amphibia hspa5-prov 32
(Danio rerio)
Actinopterygii hspa5 33 32
  • 77.55 (n)
Dr.26116 32
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.11216 32
fruit fly
(Drosophila melanogaster)
Insecta Hsc70-3 33 32
  • 73.49 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004192 32
  • 71.81 (n)
(Caenorhabditis elegans)
Secernentea hsp-4 33
  • 75 (a)
hsp-3 33 32
  • 71.02 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0D09559g 32
  • 64.93 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes KAR2 35 32
  • 64.59 (n)
SSA2 33
  • 64 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ACR038W 32
  • 62.97 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons BIP1 32
  • 64.91 (n)
(Glycine max)
eudicotyledons Gma.17631 32
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.4801 32
(Oryza sativa)
Liliopsida Os02g0115900 32
  • 66.13 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 79 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes bip1 32
  • 66.83 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU03982 32
  • 65.76 (n)
Species where no ortholog for HSPA5 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for HSPA5 Gene

Gene Tree for HSPA5 (if available)
Gene Tree for HSPA5 (if available)
Evolutionary constrained regions (ECRs) for HSPA5: view image

Paralogs for HSPA5 Gene

(14) SIMAP similar genes for HSPA5 Gene using alignment to 1 proteins:

  • GRP78_HUMAN Pseudogenes for HSPA5 Gene

genes like me logo Genes that share paralogs with HSPA5: view

Variants for HSPA5 Gene

Sequence variations from dbSNP and Humsavar for HSPA5 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs1000089203 -- 125,242,018(-) T/C upstream_transcript_variant
rs1000192312 -- 125,241,627(-) C/G upstream_transcript_variant
rs1001027372 -- 125,235,962(-) TGGATT/T 3_prime_UTR_variant
rs1001147608 -- 125,243,149(-) G/A upstream_transcript_variant
rs1001276387 -- 125,234,659(-) TATATATGTATACATAAACACATATATATGTATACATA/TATATATGTATACATA downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for HSPA5 Gene

Variant ID Type Subtype PubMed ID
nsv982345 CNV duplication 23825009

Variation tolerance for HSPA5 Gene

Residual Variation Intolerance Score: 14.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.09; 22.11% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HSPA5 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HSPA5 Gene

Disorders for HSPA5 Gene

MalaCards: The human disease database

(14) MalaCards diseases for HSPA5 Gene - From: HGMD, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
  • disseminated mucormycosis
wolfram syndrome 1
  • wfs1
wolfram syndrome
  • wfs
halothane hepatitis
  • hepatitis halothane
hepatitis a
  • viral hepatitis a
- elite association - COSMIC cancer census association via MalaCards
Search HSPA5 in MalaCards View complete list of genes associated with diseases


  • Note=Autoantigen in rheumatoid arthritis. {ECO:0000269 PubMed:11160188}.

Additional Disease Information for HSPA5

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with HSPA5: view

No data available for Genatlas for HSPA5 Gene

Publications for HSPA5 Gene

  1. Chaperone-Mediated Sec61 Channel Gating during ER Import of Small Precursor Proteins Overcomes Sec61 Inhibitor-Reinforced Energy Barrier. (PMID: 29719251) Haßdenteufel S … Zimmermann R (Cell reports 2018) 3 4 56
  2. A novel link between Fic (filamentation induced by cAMP)-mediated adenylylation/AMPylation and the unfolded protein response. (PMID: 25601083) Sanyal A … Mattoo S (The Journal of biological chemistry 2015) 3 4 56
  3. A newly uncovered group of distantly related lysine methyltransferases preferentially interact with molecular chaperones to regulate their activity. (PMID: 23349634) Cloutier P … Coulombe B (PLoS genetics 2013) 3 4 56
  4. Identification and characterization of a novel human methyltransferase modulating Hsp70 protein function through lysine methylation. (PMID: 23921388) Jakobsson ME … Falnes PØ (The Journal of biological chemistry 2013) 3 4 56
  5. Unraveling the role of KIAA1199, a novel endoplasmic reticulum protein, in cancer cell migration. (PMID: 23990668) Evensen NA … Cao J (Journal of the National Cancer Institute 2013) 3 4 56

Products for HSPA5 Gene

  • Addgene plasmids for HSPA5

Sources for HSPA5 Gene