Aliases for HOXA13 Gene
Aliases for HOXA13 Gene
External Ids for HOXA13 Gene
- HGNC: 5102
- Entrez Gene: 3209
- Ensembl: ENSG00000106031
- OMIM: 142959
- UniProtKB: P31271
Previous HGNC Symbols for HOXA13 Gene
- HOX1J
- HOX1
Previous GeneCards Identifiers for HOXA13 Gene
- GC07M026880
- GC07M026944
- GC07M026978
- GC07M027009
- GC07M027203
- GC07M027235
- GC07M027246
- GC07M027256
- GC07M027194
Summaries for HOXA13 Gene
-
In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
GeneCards Summary for HOXA13 Gene
HOXA13 (Homeobox A13) is a Protein Coding gene. Diseases associated with HOXA13 include Hand-Foot-Genital Syndrome and Preaxial Deficiency, Postaxial Polydactyly, And Hypospadias. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and transcription regulatory region DNA binding. An important paralog of this gene is HOXC13.
UniProtKB/Swiss-Prot for HOXA13 Gene
-
Sequence-specific, AT-rich binding transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis.
-
Sequence-specific transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis.
Additional gene information for HOXA13 Gene
- Monarch Initiative
- Search for HOXA13 at DataMed
- Search for HOXA13 at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HOXA13 Gene
Genomics for HOXA13 Gene
GeneHancer (GH) Regulatory Elements for HOXA13 Gene
Promoters and enhancers for HOXA13 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around HOXA13 on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Locations for HOXA13 Gene
Genomic Locations for HOXA13 Gene
- chr7:27,193,419-27,200,266
- (GRCh38/hg38)
- Size:
- 6,848 bases
- Orientation:
- Minus strand
- chr7:27,233,122-27,239,725
- (GRCh37/hg19)
Genomic View for HOXA13 Gene
Genes around HOXA13 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 7p15.2 by Ensembl
- 7p15.2 by Entrez Gene
- 7p15.2 by HGNC
HOXA13 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for HOXA13 Gene
Proteins for HOXA13 Gene
-
Protein details for HOXA13 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P31271-HXA13_HUMAN
- Recommended name:
- Homeobox protein Hox-A13
- Protein Accession:
- P31271
- A4D188
- O43371
Protein attributes for HOXA13 Gene
- Size:
- 388 amino acids
- Molecular mass:
- 39727 Da
- Quaternary structure:
-
- Binds DNA as a homodimer. Interacts with MEIS1, MEIS2 and MEIS3 (By similarity).
Protein Expression for HOXA13 Gene
Post-translational modifications for HOXA13 Gene
Other Protein References for HOXA13 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for HOXA13
-
Abcam antibodies for HOXA13
- Invitrogen Antibodies for HOXA13
- Search GeneTex for Antibodies for HOXA13
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for HOXA13
- Origene Custom Protein Services for HOXA13
- Novus Biologicals proteins for HOXA13
- antibodies-online: Search results for 4 available HOXA13 Proteins ranked by validation data
- Compare Top HOXA13 Proteins
-
Quality Products:
- Search GeneTex for Proteins for HOXA13
-
Abcam proteins for HOXA13
Assay Products
No data available for DME Specific Peptides for HOXA13 Gene
Domains & Families for HOXA13 Gene
Gene Families for HOXA13 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Cancer-related genes
- Disease related genes
- Predicted intracellular proteins
- Transcription factors
Protein Domains for HOXA13 Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for HOXA13 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P31271- Family:
-
- Belongs to the Abd-B homeobox family.
Function for HOXA13 Gene
Molecular function for HOXA13 Gene
- GENATLAS Biochemistry:
- homeo box A13(1J),homologous to mouse Hox-1.10 (hypodactyly),expressed in the developing lower genitourinary tract (abnormal seminal vesicle and prostate development),altered in hypodactyly mutants
- UniProtKB/Swiss-Prot Function:
- Sequence-specific, AT-rich binding transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis.
- UniProtKB/Swiss-Prot Function:
- Sequence-specific transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis.
Phenotypes From GWAS Catalog for HOXA13 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003677 | DNA binding | TAS | 9020844 |
| GO:0043565 | sequence-specific DNA binding | IMP | 23332764 |
Phenotypes for HOXA13 Gene
- MGI mutant phenotypes for HOXA13:
-
inferred from 7 alleles
- homeostasis/metabolism phenotype
- cardiovascular system phenotype
- mortality/aging
- growth/size/body region phenotype
- digestive/alimentary phenotype
- endocrine/exocrine gland phenotype
- reproductive system phenotype
- vision/eye phenotype
- integument phenotype
- embryo phenotype
- skeleton phenotype
- renal/urinary system phenotype
- limbs/digits/tail phenotype
- GenomeRNAi human phenotypes for HOXA13:
-
- Increased viability
- Increased vaccinia virus (VACV) infection
- Negative genetic interaction between MUS81-/- and MUS81+/+
- Decreased shRNA abundance (Z-score < -2)
- Increased shRNA abundance (Z-score > 2)
- Decreased IL-8 secretion
- Negative genetic interaction between PTTG1-/- and PTTG1+/+
- Upregulation of Wnt/beta-catenin pathway after WNT3A stimulation
Animal Models for HOXA13 Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for HOXA13
-
-
ViGene Biosciences lentiviral particle packaged cDNA for HOXA13 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for HOXA13 gene
- Search ViGene Biosciences for HOXA13
CRISPR Products
-
OriGene CRISPR knockouts for HOXA13
- genomics-online: gRNA clones - Search results for available HOXA13 gene related products
- Applied Biological Materials CRISPR for HOXA13
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for HOXA13
- GenScript: Design CRISPR guide RNA sequences for HOXA13
miRNA for HOXA13 Gene
- miRTarBase miRNAs that target HOXA13
-
- hsa-mir-142-3p (MIRT021544)
- hsa-mir-215-5p (MIRT024658)
- hsa-mir-192-5p (MIRT026124)
- hsa-mir-760 (MIRT036765)
- hsa-mir-125b-5p (MIRT045907)
- hsa-mir-222-3p (MIRT046676)
- hsa-mir-519d-5p (MIRT320503)
- hsa-mir-3611 (MIRT497028)
- hsa-mir-4252 (MIRT497029)
- hsa-mir-551b-5p (MIRT497030)
- hsa-mir-197-3p (MIRT532475)
- hsa-mir-6828-5p (MIRT532476)
- hsa-mir-4696 (MIRT532477)
- hsa-mir-6837-3p (MIRT532478)
- hsa-mir-6754-3p (MIRT532479)
- hsa-mir-412-3p (MIRT532480)
- hsa-mir-3922-5p (MIRT532481)
- hsa-mir-451b (MIRT532482)
- hsa-mir-6807-3p (MIRT532483)
- hsa-mir-217 (MIRT532484)
- hsa-mir-4643 (MIRT532485)
- hsa-mir-7109-5p (MIRT532486)
- hsa-mir-6885-5p (MIRT532487)
- hsa-mir-328-5p (MIRT532488)
- hsa-mir-6887-5p (MIRT532489)
- hsa-mir-6795-5p (MIRT532490)
- hsa-mir-625-5p (MIRT532491)
- hsa-mir-4668-5p (MIRT532492)
- hsa-mir-3148 (MIRT532493)
- hsa-mir-637 (MIRT532494)
- hsa-mir-4286 (MIRT532495)
- hsa-mir-5003-5p (MIRT532496)
- hsa-mir-3529-3p (MIRT532497)
- hsa-mir-6732-3p (MIRT532498)
- hsa-mir-4668-3p (MIRT532499)
- hsa-mir-605-5p (MIRT532500)
- hsa-mir-548c-3p (MIRT532501)
- hsa-mir-6738-3p (MIRT557129)
- hsa-mir-544a (MIRT557130)
- hsa-mir-374b-3p (MIRT557131)
- hsa-mir-4477a (MIRT557132)
- hsa-mir-889-3p (MIRT557133)
- hsa-mir-548au-3p (MIRT557134)
- hsa-mir-5589-3p (MIRT557135)
- hsa-mir-496 (MIRT557136)
- hsa-mir-17-3p (MIRT557137)
- hsa-mir-1205 (MIRT557138)
- hsa-mir-1184 (MIRT557139)
- hsa-mir-3158-5p (MIRT557140)
- hsa-mir-5190 (MIRT557141)
- hsa-mir-4496 (MIRT557142)
- hsa-mir-5197-5p (MIRT557143)
- hsa-mir-559 (MIRT557144)
- hsa-mir-548y (MIRT557145)
- hsa-mir-548w (MIRT557146)
- hsa-mir-548o-5p (MIRT557147)
- hsa-mir-548j-5p (MIRT557148)
- hsa-mir-548i (MIRT557149)
- hsa-mir-548h-5p (MIRT557150)
- hsa-mir-548d-5p (MIRT557151)
- hsa-mir-548c-5p (MIRT557152)
- hsa-mir-548bb-5p (MIRT557153)
- hsa-mir-548b-5p (MIRT557154)
- hsa-mir-548ay-5p (MIRT557155)
- hsa-mir-548au-5p (MIRT557156)
- hsa-mir-548as-5p (MIRT557157)
- hsa-mir-548ar-5p (MIRT557158)
- hsa-mir-548aq-5p (MIRT557159)
- hsa-mir-548ap-5p (MIRT557160)
- hsa-mir-548am-5p (MIRT557161)
- hsa-mir-548ak (MIRT557162)
- hsa-mir-548ae-5p (MIRT557163)
- hsa-mir-548ad-5p (MIRT557164)
- hsa-mir-548ab (MIRT557165)
- hsa-mir-548a-5p (MIRT557166)
- hsa-mir-583 (MIRT557167)
- hsa-mir-1276 (MIRT557168)
- hsa-mir-4311 (MIRT557169)
- hsa-mir-34c-5p (MIRT557170)
- hsa-mir-449a (MIRT557171)
- hsa-mir-449b-5p (MIRT557172)
- hsa-mir-34a-5p (MIRT557173)
- hsa-mir-6081 (MIRT562163)
- hsa-mir-8064 (MIRT562164)
- hsa-mir-4254 (MIRT562165)
- hsa-mir-3620-3p (MIRT562166)
- hsa-mir-4308 (MIRT562167)
- hsa-mir-92b-3p (MIRT562168)
- hsa-mir-92a-3p (MIRT562169)
- hsa-mir-367-3p (MIRT562170)
- hsa-mir-363-3p (MIRT562171)
- hsa-mir-32-5p (MIRT562172)
- hsa-mir-25-3p (MIRT562173)
- hsa-mir-504-5p (MIRT562174)
- hsa-mir-4290 (MIRT627037)
- hsa-mir-6809-3p (MIRT627038)
- hsa-mir-6833-3p (MIRT627039)
- hsa-mir-4768-5p (MIRT627040)
- hsa-mir-6873-3p (MIRT627041)
- hsa-mir-6749-3p (MIRT627042)
- hsa-mir-6792-3p (MIRT627043)
- hsa-mir-4691-5p (MIRT627044)
- hsa-mir-539-3p (MIRT627045)
- hsa-mir-485-3p (MIRT627046)
- hsa-mir-1236-3p (MIRT627047)
- hsa-mir-6515-3p (MIRT627048)
- hsa-mir-6845-3p (MIRT627049)
- hsa-mir-660-3p (MIRT627050)
- hsa-mir-5193 (MIRT627051)
- hsa-mir-1-5p (MIRT627052)
- hsa-mir-3675-3p (MIRT627053)
miRNA Products
- Search ViGene Biosciences for HOXA13
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for HOXA13
- Browse OriGene Inhibitory RNA Products For HOXA13
- genomics-online: shRNA clones - Search results for available HOXA13 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for HOXA13 gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for HOXA13
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HOXA13
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for HOXA13
- genomics-online: cdna clones - Search results for available HOXA13 gene related products
- orf clones - Search results for available HOXA13 gene related products
- Applied Biological Materials Clones for HOXA13
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for HOXA13
-
ViGene Biosciences adenoviral particle packaged cDNA for HOXA13 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for HOXA13 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for HOXA13 gene
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for HOXA13 Gene
Localization for HOXA13 Gene
Subcellular locations from UniProtKB/Swiss-Prot for HOXA13 Gene
- Nucleus.
| Compartment | Confidence |
|---|---|
| cytoskeleton | 5 |
| nucleus | 5 |
| extracellular | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005634 | nucleus | IEA | -- |
| GO:0005654 | nucleoplasm | IDA | -- |
| GO:0045111 | intermediate filament cytoskeleton | IDA | -- |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for HOXA13 Gene
Pathways & Interactions for HOXA13 Gene
No Data Available
Interacting Proteins for HOXA13 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001501 | skeletal system development | TAS | 9020844 |
| GO:0006351 | transcription, DNA-templated | IEA | -- |
| GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
| GO:0007275 | multicellular organism development | IEA | -- |
No data available for Pathways by source for HOXA13 Gene
Transcripts for HOXA13 Gene
mRNA/cDNA for HOXA13 Gene
- (1) REFSEQ mRNAs :
- (2) Additional mRNA sequences :
- (47) Selected AceView cDNA sequences:
- (2) Ensembl transcripts including schematic representations, and UCSC links where relevant :
CRISPR Products
-
OriGene CRISPR knockouts for HOXA13
- genomics-online: gRNA clones - Search results for available HOXA13 gene related products
- Applied Biological Materials CRISPR for HOXA13
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for HOXA13
- GenScript: Design CRISPR guide RNA sequences for HOXA13
miRNA Products
- Search ViGene Biosciences for HOXA13
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for HOXA13
- Browse OriGene Inhibitory RNA Products For HOXA13
- genomics-online: shRNA clones - Search results for available HOXA13 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for HOXA13 gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for HOXA13
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HOXA13
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for HOXA13
- genomics-online: cdna clones - Search results for available HOXA13 gene related products
- orf clones - Search results for available HOXA13 gene related products
- Applied Biological Materials Clones for HOXA13
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for HOXA13 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- NULL (Uncategorized)
- Umbilical Cord (Extraembryonic Tissues)
- Mesenchymal Stem Cells (Uncategorized)
- Bone (Muscoskeletal System)
-
Limb (Muscoskeletal System)
- Prechondrocytic Mesenchymal Cells Autopod
- Limb Bud Mesenchyme Cells Limb Bud
- Lower Urinary Tract (Urinary System)
- Cartilage (Muscoskeletal System)
-
Mesoderm (Gastrulation Derivatives)
- Limb Bud Mesenchyme Cells Limb Bud
-
Placenta (Extraembryonic Tissues)
-
Prostate (Endocrine System)
-
Colon (Gastrointestinal Tract)
mRNA differential expression in normal tissues according to GTEx for HOXA13 Gene
This gene is overexpressed in Cervix - Ectocervix (x11.5), Cervix - Endocervix (x11.2), Vagina (x7.6), Bladder (x7.0), Prostate (x4.9), and Colon - Transverse (x4.5).
This gene is overexpressed in Cervix (69.0).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for HOXA13 Gene
NURSA nuclear receptor signaling pathways regulating expression of HOXA13 Gene:
HOXA13SOURCE GeneReport for Unigene cluster for HOXA13 Gene:
Hs.592172Phenotype-based relationships between genes and organs from Gene ORGANizer for HOXA13 Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- immune
- integumentary
- reproductive
- skeletal muscle
- skeleton
- urinary
Regions:
Abdomen:
- kidney
Pelvis:
- ovary
- penis
- ureter
- urethra
- urinary bladder
- uterus
- vagina
Limb:
- digit
- finger
- foot
- hand
- lower limb
- nail
- toe
- upper limb
General:
- blood
- skin
- white blood cell
Primer Products
-
OriGene qPCR primer pairs for HOXA13
-
OriGene qPCR primer pairs and template standards for HOXA13
- genomics-online: primer clones - Search results for available HOXA13 gene related products
Gene Expression Assay Products
No data available for mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for HOXA13 Gene
Orthologs for HOXA13 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | HOXA13 33 34 |
|
||
| dog (Canis familiaris) |
Mammalia | HOXA13 33 34 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | HOXA13 34 |
|
OneToOne | |
| mouse (Mus musculus) |
Mammalia | Hoxa13 33 16 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Hoxa13 33 |
|
||
| cow (Bos Taurus) |
Mammalia | HOXA13 33 34 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | HOXA13 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | HOXA13 34 34 34 |
|
OneToMany | |
| LOC100859244 33 |
|
||||
| lizard (Anolis carolinensis) |
Reptilia | HOXA13 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | hoxa13 33 |
|
||
| African clawed frog (Xenopus laevis) |
Amphibia | hoxa13-A 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | hoxa13b 33 34 |
|
||
| hoxa13a 34 |
|
OneToMany | |||
| fruit fly (Drosophila melanogaster) |
Insecta | Abd-B 34 |
|
OneToMany |
- Species where no ortholog for HOXA13 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for HOXA13 Gene
Paralogs for HOXA13 Gene
(5) SIMAP similar genes for HOXA13 Gene using alignment to 3 proteins:
Variants for HOXA13 Gene
| SNP ID | Clin | Chr 07 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs104894019 | pathogenic, Hand foot uterus syndrome | 27,198,258(-) | C/T | coding_sequence_variant, stop_gained | |
| rs121912542 | pathogenic, Hand foot uterus syndrome, Hand-foot-genital syndrome (HFG) [MIM:140000] | 27,198,251(-) | T/G | coding_sequence_variant, missense_variant | |
| rs387906542 | pathogenic, Hand foot uterus syndrome | 27,199,672(-) | AGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC/AGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGCAGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC | coding_sequence_variant, frameshift | |
| VAR_017775 | Guttmacher syndrome (GUTTS) [MIM:176305] | p.Gln371Leu | |||
| VAR_075341 | Hand-foot-genital syndrome (HFG) [MIM:140000] | p.Ile368Phe |
Residual Variation Intolerance Score:
51.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
2.41;
42.64% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for HOXA13 Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HOXA13 Gene
Disorders for HOXA13 Gene
(8) MalaCards diseases for HOXA13 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| hand-foot-genital syndrome |
|
|
| preaxial deficiency, postaxial polydactyly, and hypospadias |
|
|
| hypospadias |
|
|
| invasive bladder transitional cell carcinoma |
|
|
| inflammatory bowel disease 2 |
|
|
Search HOXA13 in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
HXA13_HUMAN- Guttmacher syndrome (GUTTS) [MIM:176305]: Dominantly inherited combination of distal limb and genital tract abnormalities. It has several features in common with hand-foot-genital syndrome, including hypoplastic first digits and hypospadias. Typical features not seen in hand-foot-genital syndrome include postaxial polydactyly of the hands and uniphalangeal second toes with absent nails. {ECO:0000269 PubMed:11968094}. Note=The disease is caused by mutations affecting the gene represented in this entry.
- Hand-foot-genital syndrome (HFG) [MIM:140000]: A disorder characterized by limb and genitourinary anomalies. Clinical features include small feet with unusually short great toes and abnormal thumbs. Females with the disorder have duplication of the genital tract. {ECO:0000269 PubMed:10839976, ECO:0000269 PubMed:12073020, ECO:0000269 PubMed:24934387, ECO:0000269 PubMed:26590955}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for HOXA13
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for HOXA13 Gene
Publications for HOXA13 Gene
- A HOXA13 allele with a missense mutation in the homeobox and a dinucleotide deletion in the promoter underlies Guttmacher syndrome. (PMID: 11968094) Innis JW … Guttmacher AE (Human mutation 2002) 3 4 22 58
- Novel HOXA13 mutations and the phenotypic spectrum of hand-foot-genital syndrome. (PMID: 10839976) Goodman FR … Scambler PJ (American journal of human genetics 2000) 3 4 22 58
- Mutation of HOXA13 in hand-foot-genital syndrome. (PMID: 9020844) Mortlock DP … Innis JW (Nature genetics 1997) 3 4 22 58
- Dual genetic diagnoses: Atypical hand-foot-genital syndrome and developmental delay due to de novo mutations in HOXA13 and NRXN1. (PMID: 26590955) Wallis M … Patel C (American journal of medical genetics. Part A 2016) 3 4 58
- Structural basis for sequence specific DNA binding and protein dimerization of HOXA13. (PMID: 21829694) Zhang Y … Ames JB (PloS one 2011) 3 4 58
Products for HOXA13 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for HOXA13
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for HOXA13
- Origene Custom Protein Services for HOXA13
- Origene shrna, sirna, and RNAi products in human, mouse, rat for HOXA13
- Browse OriGene Inhibitory RNA Products For HOXA13
- OriGene qPCR primer pairs and template standards for HOXA13
- OriGene qPCR primer pairs for HOXA13
- OriGene CRISPR knockouts for HOXA13
- OriGene ORF clones in human for HOXA13
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For HOXA13
- GenScript: Next-day shipping of latest version cDNA ORF clones for HOXA13 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for HOXA13
- GenScript Custom Assay Services for HOXA13
- GenScript Custom overexpressing Cell Line Services for HOXA13
- GenScript: Design CRISPR guide RNA sequences for HOXA13
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for HOXA13
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals proteins for HOXA13
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for HOXA13
- Abcam proteins for HOXA13
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Cyagen custom Knockout/knockin (KOKI) mouse models for HOXA13
- VectorBuilder custom plasmid, inducible vectors for HOXA13
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HOXA13
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for HOXA13
- antibodies-online: Search results for 44 available HOXA13 Antibodies ranked by validation data
- Compare Top HOXA13 Antibodies
- antibodies-online: Search results for available HOXA13 related products ranked by validation data
- antibodies-online: Search results for 4 available HOXA13 Proteins ranked by validation data
- Compare Top HOXA13 Proteins
- Quality Products:
- Search GeneTex for Antibodies for HOXA13
- Search GeneTex for Proteins for HOXA13
- ViGene Biosciences adenoviral particle packaged cDNA for HOXA13 gene
- ViGene Biosciences lentiviral particle packaged cDNA for HOXA13 gene
- ViGene Biosciences ready-to-package AAV shRNAs for HOXA13 gene
- Search ViGene Biosciences for HOXA13
- Horizon Cell Lines for HOXA13
- genomics-online: cdna clones - Search results for available HOXA13 gene related products
- orf clones - Search results for available HOXA13 gene related products
- genomics-online: gRNA clones - Search results for available HOXA13 gene related products
- genomics-online: primer clones - Search results for available HOXA13 gene related products
- genomics-online: shRNA clones - Search results for available HOXA13 gene related products
Sources for HOXA13 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems