Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HOTTIP Gene

Subcategory (RNA class) for HOTTIP Gene

non-coding RNA

Quality Score for this RNA gene is

13

Aliases for HOTTIP Gene

  • HOXA Distal Transcript Antisense RNA 2 3 5
  • HOXA Distal Transcript Antisense RNA (Non-Protein Coding) 2 3
  • HOXA Cluster Antisense RNA 6 (Non-Protein Coding) 2 3
  • HOXA13 Antisense RNA 1 (Non-Protein Coding) 2 3
  • HOXA Transcript At The Distal Tip 2
  • HoxA Transcript At The Distal Tip 3
  • Non-Protein Coding RNA 213 2
  • HOXA13-AS1 3
  • NCRNA00213 3
  • HOXA-AS6 3

External Ids for HOTTIP Gene

Previous HGNC Symbols for HOTTIP Gene

  • NCRNA00213

Previous GeneCards Identifiers for HOTTIP Gene

  • GC07P027246
  • GC07P027249
  • GC07P027251
  • GC07P027257

Summaries for HOTTIP Gene

Entrez Gene Summary for HOTTIP Gene

  • This gene produces a long RNA in antisense to the HOXA gene cluster. This transcript may regulate expression of HOXA genes in cis. This gene is upregulated in tumors and is implicated in the promotion of cell proliferation. [provided by RefSeq, Dec 2017]

GeneCards Summary for HOTTIP Gene

HOTTIP (HOXA Distal Transcript Antisense RNA) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for HOTTIP Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HOTTIP Gene

Genomics for HOTTIP Gene

GeneHancer (GH) Regulatory Elements for HOTTIP Gene

Promoters and enhancers for HOTTIP Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH07I027199 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE dbSUPER 550.8 +1.8 1787 1.5 INSM2 KLF17 SIN3A ZNF76 GLI4 ZNF2 ZEB1 ZNF335 GLIS2 ZNF213 ENSG00000276609 ENSG00000277469 ENSG00000278708 HOTTIP HOXA13 HOXA10-AS
GH07I027197 Enhancer 0.6 ENCODE dbSUPER 550.8 -0.8 -818 0 RNF2 PRDM1 EZH2 GC07M027197 GC07M027198 HOTTIP HOXA13
GH07I027198 Enhancer 0.6 ENCODE dbSUPER 550.8 -0.3 -318 0.2 ZBTB48 ZNF600 EZH2 GC07M027197 GC07M027198 HOTTIP HOXA13
GH07I027200 Enhancer 0.6 ENCODE dbSUPER 550.8 -0.7 -697 0 RNF2 EZH2 GC07M027197 GC07M027198 HOTTIP HOXA13
GH07I027095 Promoter/Enhancer 3.4 VISTA UCNEbase EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.2 -60.4 -60380 86.3 MLX FEZF1 DMAP1 YY1 ZNF213 ZNF143 SP3 NFYC SSRP1 ZNF610 HOXA2 HOXA9 HOXA10 HOXA1 HOXA3 HOXA6 HOXA4 HOXA5 HOXA7 HNRNPA2B1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around HOTTIP on UCSC Golden Path with GeneCards custom track

Genomic Locations for HOTTIP Gene

Genomic Locations for HOTTIP Gene
chr7:27,198,575-27,207,259
(GRCh38/hg38)
Size:
8,685 bases
Orientation:
Plus strand
chr7:27,238,194-27,246,878
(GRCh37/hg19)

Genomic View for HOTTIP Gene

Genes around HOTTIP on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HOTTIP Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HOTTIP Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HOTTIP Gene

Proteins for HOTTIP Gene

Post-translational modifications for HOTTIP Gene

No Post-translational modifications

No data available for DME Specific Peptides for HOTTIP Gene

Domains & Families for HOTTIP Gene

Gene Families for HOTTIP Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with HOTTIP: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for HOTTIP Gene

Function for HOTTIP Gene

Phenotypes From GWAS Catalog for HOTTIP Gene

Animal Model Products

miRNA for HOTTIP Gene

miRTarBase miRNAs that target HOTTIP

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for HOTTIP Gene

Localization for HOTTIP Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for HOTTIP Gene

Pathways & Interactions for HOTTIP Gene

SuperPathways for HOTTIP Gene

No Data Available

Interacting Proteins for HOTTIP Gene

Gene Ontology (GO) - Biological Process for HOTTIP Gene

None

No data available for Pathways by source and SIGNOR curated interactions for HOTTIP Gene

Drugs & Compounds for HOTTIP Gene

No Compound Related Data Available

Transcripts for HOTTIP Gene

mRNA/cDNA for HOTTIP Gene

(3) Additional mRNA sequences :
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HOTTIP Gene

HOXA distal transcript antisense RNA:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for HOTTIP Gene

No ASD Table

Relevant External Links for HOTTIP Gene

GeneLoc Exon Structure for
HOTTIP
ECgene alternative splicing isoforms for
HOTTIP

Expression for HOTTIP Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HOTTIP Gene

mRNA differential expression in normal tissues according to GTEx for HOTTIP Gene

This gene is overexpressed in Colon - Transverse (x15.4), Cervix - Endocervix (x8.3), Cervix - Ectocervix (x7.9), Prostate (x7.7), Vagina (x6.2), and Bladder (x5.4).

NURSA nuclear receptor signaling pathways regulating expression of HOTTIP Gene:

HOTTIP

SOURCE GeneReport for Unigene cluster for HOTTIP Gene:

Hs.199486
genes like me logo Genes that share expression patterns with HOTTIP: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for HOTTIP Gene

Orthologs for HOTTIP Gene

Evolution for HOTTIP Gene

ENSEMBL:
Gene Tree for HOTTIP (if available)
TreeFam:
Gene Tree for HOTTIP (if available)

No data available for Orthologs for HOTTIP Gene

Paralogs for HOTTIP Gene

No data available for Paralogs for HOTTIP Gene

Variants for HOTTIP Gene

Sequence variations from dbSNP and Humsavar for HOTTIP Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs387906542 pathogenic, Hand foot uterus syndrome 27,199,672(+) AGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC/AGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGCAGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC upstream_transcript_variant
rs35277569 likely-benign, not provided 27,199,445(+) C/A/T upstream_transcript_variant
rs1000060724 -- 27,207,507(+) T/C downstream_transcript_variant
rs1000111576 -- 27,200,792(+) G/A non_coding_transcript_variant
rs1000450095 -- 27,198,768(+) T/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for HOTTIP Gene

Variant ID Type Subtype PubMed ID
dgv1094n67 CNV gain 20364138
nsv519583 CNV gain 19592680
nsv5675 CNV insertion 18451855
nsv606468 CNV loss 21841781
nsv606469 CNV loss 21841781
nsv7393 OTHER inversion 18451855
nsv824042 CNV gain 20364138

Additional Variant Information for HOTTIP Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
HOTTIP

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for HOTTIP Gene

Disorders for HOTTIP Gene

Additional Disease Information for HOTTIP

No disorders were found for HOTTIP Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for HOTTIP Gene

Publications for HOTTIP Gene

  1. Multiple knockout mouse models reveal lincRNAs are required for life and brain development. (PMID: 24381249) Sauvageau M … Rinn JL (eLife 2013) 2 3 58
  2. A long noncoding RNA maintains active chromatin to coordinate homeotic gene expression. (PMID: 21423168) Wang KC … Chang HY (Nature 2011) 2 3 58
  3. Non-coding RNA: HOTTIP goes the distance. (PMID: 21483457) Burgess DJ (Nature reviews. Genetics 2011) 2 3 58
  4. Knockdown of the long non-coding RNA HOTTIP inhibits colorectal cancer cell proliferation and migration and induces apoptosis by targeting SGK1. (PMID: 29274585) Liu T … He K (Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2018) 3 58
  5. Long noncoding RNA HOTTIP promotes endothelial cell proliferation and migration via activation of the Wnt/β-catenin pathway. (PMID: 29058802) Liao B … Dong S (Journal of cellular biochemistry 2018) 3 58

Products for HOTTIP Gene

Sources for HOTTIP Gene

Content
Loading form....