Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HIST1H4F Gene

Aliases for HIST1H4F Gene

  • Histone Cluster 1 H4 Family Member F 2 3 5
  • H4 Histone Family, Member C 2 3
  • Histone Cluster 1, H4f 2 3
  • Histone 1, H4f 2 3
  • H4/C 3 4
  • H4FC 3 4
  • Histone H4 3
  • HIST2H4 4
  • H4/A 4
  • H4/B 4
  • H4/D 4
  • H4/E 4
  • H4/G 4
  • H4/H 4
  • H4/I 4
  • H4/J 4
  • H4/K 4
  • H4/M 4
  • H4/N 4
  • H4/O 4
  • H4F2 4
  • H4FA 4
  • H4FB 4
  • H4FD 4
  • H4FE 4
  • H4FG 4
  • H4FH 4
  • H4FI 4
  • H4FJ 4
  • H4FK 4
  • H4FM 4
  • H4FN 4
  • H4FO 4
  • H4 3

External Ids for HIST1H4F Gene

Previous HGNC Symbols for HIST1H4F Gene

  • H4FC

Previous GeneCards Identifiers for HIST1H4F Gene

  • GC06P026298
  • GC06P026348
  • GC06P026184

Summaries for HIST1H4F Gene

Entrez Gene Summary for HIST1H4F Gene

  • Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]

GeneCards Summary for HIST1H4F Gene

HIST1H4F (Histone Cluster 1 H4 Family Member F) is a Protein Coding gene. Among its related pathways are Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 and Cell Cycle, Mitotic. Gene Ontology (GO) annotations related to this gene include histone binding. An important paralog of this gene is HIST4H4.

UniProtKB/Swiss-Prot for HIST1H4F Gene

  • Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Gene Wiki entry for HIST1H4F Gene

Additional gene information for HIST1H4F Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HIST1H4F Gene

Genomics for HIST1H4F Gene

GeneHancer (GH) Regulatory Elements for HIST1H4F Gene

Promoters and enhancers for HIST1H4F Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06J026239 Promoter/Enhancer 1.5 Ensembl ENCODE 650.7 +1.7 1749 5.3 SMAD1 RB1 SIN3A BMI1 BATF CHAMP1 YY1 ETS1 ELK1 ATF7 GC06P027227 HIST1H4F HIST1H3G HIST1H2APS4 HIST1H3E BTN2A1 ZNF322 HIST1H4G
GH06J026193 Promoter/Enhancer 1.9 Ensembl ENCODE dbSUPER 10.7 -39.6 -39634 14.6 ZFP64 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC ENSG00000282988 HIST1H2AD HIST1H2BF HIST1H3D RPS10P1 ABT1 HMGN4 BTN2A3P BTN2A1 BTN2A2
GH06J026567 Enhancer 1.5 Ensembl ENCODE dbSUPER 9.6 +330.1 330101 5.3 MLX FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 LOC105374988 TRY-GTA1-1 ABT1 BTN3A2 HMGN4 LOC102724851 BTN2A1 BTN2A3P ZNF322 HCG11
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around HIST1H4F on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HIST1H4F gene promoter:
  • ARP-1
  • GR-beta
  • GR-alpha
  • GR
  • SRF
  • SRF (504 AA)
  • STAT3
  • AREB6
  • E2F-1
  • E2F

Genomic Locations for HIST1H4F Gene

Genomic Locations for HIST1H4F Gene
368 bases
Plus strand
461 bases
Plus strand

Genomic View for HIST1H4F Gene

Genes around HIST1H4F on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HIST1H4F Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HIST1H4F Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HIST1H4F Gene

Proteins for HIST1H4F Gene

  • Protein details for HIST1H4F Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Histone H4
    Protein Accession:
    Secondary Accessions:
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7

    Protein attributes for HIST1H4F Gene

    103 amino acids
    Molecular mass:
    11367 Da
    Quaternary structure:
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for HIST1H4F Gene

neXtProt entry for HIST1H4F Gene

Post-translational modifications for HIST1H4F Gene

  • Acetylation at Lys-6 (H4K5ac), Lys-9 (H4K8ac), Lys-13 (H4K12ac) and Lys-17 (H4K16ac) occurs in coding regions of the genome but not in heterochromatin.
  • Citrullination at Arg-4 (H4R3ci) by PADI4 impairs methylation.
  • Monomethylation and asymmetric dimethylation at Arg-4 (H4R3me1 and H4R3me2a, respectively) by PRMT1 favors acetylation at Lys-9 (H4K8ac) and Lys-13 (H4K12ac). Demethylation is performed by JMJD6. Symmetric dimethylation on Arg-4 (H4R3me2s) by the PRDM1/PRMT5 complex may play a crucial role in the germ-cell lineage.
  • Monomethylated, dimethylated or trimethylated at Lys-21 (H4K20me1, H4K20me2, H4K20me3). Monomethylation is performed by SET8. Trimethylation is performed by KMT5B and KMT5C and induces gene silencing.
  • Phosphorylated by PAK2 at Ser-48 (H4S47ph). This phosphorylation increases the association of H3.3-H4 with the histone chaperone HIRA, thus promoting nucleosome assembly of H3.3-H4 and inhibiting nucleosome assembly of H3.1-H4.
  • Ubiquitinated by the CUL4-DDB-RBX1 complex in response to ultraviolet irradiation. This may weaken the interaction between histones and DNA and facilitate DNA accessibility to repair proteins. Monoubiquitinated at Lys-92 of histone H4 (H4K91ub1) in response to DNA damage. The exact role of H4K91ub1 in DNA damage response is still unclear but it may function as a licensing signal for additional histone H4 post-translational modifications such as H4 Lys-21 methylation (H4K20me).
  • Sumoylated, which is associated with transcriptional repression.
  • Crotonylation (Kcr) is specifically present in male germ cells and marks testis-specific genes in post-meiotic cells, including X-linked genes that escape sex chromosome inactivation in haploid cells. Crotonylation marks active promoters and enhancers and confers resistance to transcriptional repressors. It is also associated with post-meiotically activated genes on autosomes.
  • Butyrylation of histones marks active promoters and competes with histone acetylation.
  • Ubiquitination at isoforms=80, Lys78, isoforms=60, and Lys32
  • Modification sites at PhosphoSitePlus

Other Protein References for HIST1H4F Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for HIST1H4F Gene

Domains & Families for HIST1H4F Gene

Gene Families for HIST1H4F Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for HIST1H4F Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the histone H4 family.
  • Belongs to the histone H4 family.
genes like me logo Genes that share domains with HIST1H4F: view

No data available for Suggested Antigen Peptide Sequences for HIST1H4F Gene

Function for HIST1H4F Gene

Molecular function for HIST1H4F Gene

UniProtKB/Swiss-Prot Function:
Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Phenotypes From GWAS Catalog for HIST1H4F Gene

Gene Ontology (GO) - Molecular Function for HIST1H4F Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding TAS,IBA 3035717
GO:0003723 RNA binding HDA 22658674
GO:0005515 protein binding IPI 9540062
GO:0019904 protein domain specific binding IPI 22368283
GO:0042393 histone binding IBA --
genes like me logo Genes that share ontologies with HIST1H4F: view
genes like me logo Genes that share phenotypes with HIST1H4F: view

Animal Model Products

CRISPR Products

miRNA for HIST1H4F Gene

miRTarBase miRNAs that target HIST1H4F

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for HIST1H4F

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for HIST1H4F Gene

Localization for HIST1H4F Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HIST1H4F gene
Compartment Confidence
extracellular 5
nucleus 5
cytoskeleton 1
mitochondrion 1
cytosol 1

Gene Ontology (GO) - Cellular Components for HIST1H4F Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000228 nuclear chromosome IDA 14718166
GO:0000784 nuclear chromosome, telomeric region HDA 19135898
GO:0000786 nucleosome TAS 3035717
GO:0000788 nuclear nucleosome IBA,IDA 20498094
GO:0005576 extracellular region TAS --
genes like me logo Genes that share ontologies with HIST1H4F: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for HIST1H4F Gene

Pathways & Interactions for HIST1H4F Gene

SuperPathways for HIST1H4F Gene

SuperPathway Contained pathways
1 Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
2 DNA Double-Strand Break Repair
3 Cellular Senescence (REACTOME)
4 Chromosome Maintenance
5 Cell Cycle, Mitotic
genes like me logo Genes that share pathways with HIST1H4F: view

Gene Ontology (GO) - Biological Process for HIST1H4F Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000183 chromatin silencing at rDNA TAS --
GO:0006303 double-strand break repair via nonhomologous end joining TAS --
GO:0006334 nucleosome assembly IDA,IBA 20498094
GO:0006335 DNA replication-dependent nucleosome assembly IDA 14718166
GO:0006336 DNA replication-independent nucleosome assembly IDA 14718166
genes like me logo Genes that share ontologies with HIST1H4F: view

No data available for SIGNOR curated interactions for HIST1H4F Gene

Drugs & Compounds for HIST1H4F Gene

No Compound Related Data Available

Transcripts for HIST1H4F Gene

mRNA/cDNA for HIST1H4F Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(2) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HIST1H4F Gene

Histone cluster 1, H4f:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for HIST1H4F

Alternative Splicing Database (ASD) splice patterns (SP) for HIST1H4F Gene

No ASD Table

Relevant External Links for HIST1H4F Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for HIST1H4F Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HIST1H4F Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for HIST1H4F Gene

Protein tissue co-expression partners for HIST1H4F Gene

NURSA nuclear receptor signaling pathways regulating expression of HIST1H4F Gene:


SOURCE GeneReport for Unigene cluster for HIST1H4F Gene:


Evidence on tissue expression from TISSUES for HIST1H4F Gene

  • Liver(4.5)
  • Nervous system(4.5)
  • Eye(4.2)
  • Blood(2.4)
  • Intestine(2.3)
  • Lung(2.2)
genes like me logo Genes that share expression patterns with HIST1H4F: view

No data available for mRNA differential expression in normal tissues , Protein differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for HIST1H4F Gene

Orthologs for HIST1H4F Gene

This gene was present in the common ancestor of animals.

Orthologs for HIST1H4F Gene

Organism Taxonomy Gene Similarity Type Details
(Rattus norvegicus)
Mammalia LOC102548682 33
  • 85.11 (n)
(Mus musculus)
Mammalia Hist1h4c 16 33
  • 84.14 (n)
(Pan troglodytes)
Mammalia LOC457262 33
  • 83.82 (n)
(Bos Taurus)
Mammalia LOC527388 33
  • 80.91 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100495622 33
  • 80.91 (n)
(Danio rerio)
Actinopterygii si:ch211-113a14.9 33
  • 81.55 (n)
fruit fly
(Drosophila melanogaster)
Insecta His4:CG31611 33
  • 81.23 (n)
Species where no ortholog for HIST1H4F was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for HIST1H4F Gene

Gene Tree for HIST1H4F (if available)
Gene Tree for HIST1H4F (if available)
Evolutionary constrained regions (ECRs) for HIST1H4F: view image

Paralogs for HIST1H4F Gene

(3) SIMAP similar genes for HIST1H4F Gene using alignment to 1 proteins:

  • H4_HUMAN Pseudogenes for HIST1H4F Gene

genes like me logo Genes that share paralogs with HIST1H4F: view

Variants for HIST1H4F Gene

Sequence variations from dbSNP and Humsavar for HIST1H4F Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1000953750 -- 26,238,531(+) G/A upstream_transcript_variant
rs1002590317 -- 26,240,490(+) T/A coding_sequence_variant, missense_variant
rs1003877214 -- 26,241,034(+) G/A downstream_transcript_variant
rs1003985808 -- 26,241,266(+) TTTTTT/TTTTTTT downstream_transcript_variant
rs1004449198 -- 26,240,183(+) AGACCCAAACAAGGAAACAG/AG upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for HIST1H4F Gene

Variant ID Type Subtype PubMed ID
dgv5926n100 CNV gain 25217958
nsv1021294 CNV loss 25217958
nsv1023453 CNV gain 25217958
nsv428137 CNV loss 18775914
nsv601173 CNV loss 21841781

Variation tolerance for HIST1H4F Gene

Residual Variation Intolerance Score: 26.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.30; 6.72% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HIST1H4F Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HIST1H4F Gene

Disorders for HIST1H4F Gene


  • Note=Chromosomal aberrations involving HISTONE H4 is a cause of B-cell non-Hodgkin lymphomas (B-cell NHL). Translocation t(3;6)(q27;p21), with BCL6. {ECO:0000269 PubMed:12414651}.

Additional Disease Information for HIST1H4F

No disorders were found for HIST1H4F Gene.

No data available for MalaCards and Genatlas for HIST1H4F Gene

Publications for HIST1H4F Gene

  1. The human and mouse replication-dependent histone genes. (PMID: 12408966) Marzluff WF … Maltais LJ (Genomics 2002) 2 3 4 58
  2. Human histone gene organization: nonregular arrangement within a large cluster. (PMID: 9119399) Albig W … Doenecke D (Genomics 1997) 2 3 4 58
  3. Isolation and characterization of two human H1 histone genes within clusters of core histone genes. (PMID: 1916825) Albig W … Doenecke D (Genomics 1991) 2 3 4 58
  4. Phosphorylation of H4 Ser 47 promotes HIRA-mediated nucleosome assembly. (PMID: 21724829) Kang B … Zhang Z (Genes & development 2011) 3 4 58
  5. The human histone gene cluster at the D6S105 locus. (PMID: 9439656) Albig W … Doenecke D (Human genetics 1997) 3 4 58

Products for HIST1H4F Gene

Sources for HIST1H4F Gene

Loading form....