Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HCN4 Gene

Aliases for HCN4 Gene

  • Hyperpolarization Activated Cyclic Nucleotide Gated Potassium Channel 4 2 3 5
  • Potassium/Sodium Hyperpolarization-Activated Cyclic Nucleotide-Gated Channel 4 3
  • Hyperpolarization Activated Cyclic Nucleotide-Gated Potassium Channel 4 2
  • Hyperpolarization Activated Cyclic Nucleotide-Gated Cation Channel 4 3
  • SSS2 3

External Ids for HCN4 Gene

Previous GeneCards Identifiers for HCN4 Gene

  • GC15M069662
  • GC15M066718
  • GC15M071189
  • GC15M071329
  • GC15M071400
  • GC15M073612
  • GC15M050443

Summaries for HCN4 Gene

Entrez Gene Summary for HCN4 Gene

  • This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]

GeneCards Summary for HCN4 Gene

HCN4 (Hyperpolarization Activated Cyclic Nucleotide Gated Potassium Channel 4) is a Protein Coding gene. Diseases associated with HCN4 include Sick Sinus Syndrome 2 and Brugada Syndrome 8. Among its related pathways are Transmission across Chemical Synapses and TarBasePathway. Gene Ontology (GO) annotations related to this gene include identical protein binding and voltage-gated potassium channel activity. An important paralog of this gene is HCN2.

UniProtKB/Swiss-Prot for HCN4 Gene

  • Hyperpolarization-activated ion channel with very slow activation and inactivation exhibiting weak selectivity for potassium over sodium ions. Contributes to the native pacemaker currents in heart (If) that regulate the rhythm of heart beat. May contribute to the native pacemaker currents in neurons (Ih). May mediate responses to sour stimuli.

Gene Wiki entry for HCN4 Gene

Additional gene information for HCN4 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HCN4 Gene

Genomics for HCN4 Gene

GeneHancer (GH) Regulatory Elements for HCN4 Gene

Promoters and enhancers for HCN4 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH15I073366 Promoter/Enhancer 1.4 EPDnew Ensembl ENCODE 550.8 +0.8 819 3.2 MXI1 ZNF777 ZBTB6 SUZ12 SIN3A ZNF335 E2F1 ZFHX2 GLIS2 POLR2A GC15M073368 HCN4 ENSG00000261384 LOC105370890
GH15I073293 Enhancer 0.8 ENCODE 10.7 +75.4 75421 1.2 FOXA2 MLX RARA MIXL1 RXRA REST KAT8 NFIL3 CEBPA HNF4A HCN4 PIR39750 ENSG00000259528 NEO1
GH15I073704 Enhancer 0.8 ENCODE 9.8 -335.9 -335924 0.9 CTCF PKNOX1 ATF1 RB1 KLF17 SIN3A ZNF2 RAD21 CTBP1 POLR2A CLK3 NPTN EDC3 LOC101929333 HCN4 GC15P073700 CD276 ENSG00000276807
GH15I073700 Enhancer 0.7 ENCODE 9.8 -330.9 -330911 0.2 CTCF ARID4B KLF17 ZNF2 ZNF48 RAD21 ZEB1 ZKSCAN1 CC2D1A CTBP1 GC15P073700 NPTN HCN4 CD276
GH15I073701 Enhancer 0.7 ENCODE 9.8 -331.0 -331042 0 CTCF ARID4B ZNF2 ZNF48 RAD21 RFX5 ZKSCAN1 CC2D1A CTBP1 ARID2 GC15P073700 NPTN HCN4 CD276
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around HCN4 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HCN4 gene promoter:

Genomic Locations for HCN4 Gene

Genomic Locations for HCN4 Gene
49,406 bases
Minus strand

Genomic View for HCN4 Gene

Genes around HCN4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HCN4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HCN4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HCN4 Gene

Proteins for HCN4 Gene

  • Protein details for HCN4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4
    Protein Accession:
    Secondary Accessions:
    • Q9UMQ7

    Protein attributes for HCN4 Gene

    1203 amino acids
    Molecular mass:
    129042 Da
    Quaternary structure:
    • Homotetramer. The potassium channel is composed of a homo- or heterotetrameric complex of pore-forming subunits.
    • Inhibited by extracellular cesium ions.

    Three dimensional structures from OCA and Proteopedia for HCN4 Gene

neXtProt entry for HCN4 Gene

Post-translational modifications for HCN4 Gene

  • Glycosylation at isoforms=458
  • Modification sites at PhosphoSitePlus

Other Protein References for HCN4 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for HCN4 Gene

Domains & Families for HCN4 Gene

Gene Families for HCN4 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Potential drug targets
  • Predicted membrane proteins
  • Transporters
  • Voltage-gated ion channels

Suggested Antigen Peptide Sequences for HCN4 Gene

Graphical View of Domain Structure for InterPro Entry



  • The segment S4 is probably the voltage-sensor and is characterized by a series of positively charged amino acids at every third position.
  • Belongs to the potassium channel HCN family.
  • The segment S4 is probably the voltage-sensor and is characterized by a series of positively charged amino acids at every third position.
  • Belongs to the potassium channel HCN family.
genes like me logo Genes that share domains with HCN4: view

Function for HCN4 Gene

Molecular function for HCN4 Gene

GENATLAS Biochemistry:
hyperpolarization-activated and cyclic nucleotide gated potassium channel 4,expressed in the brain,predominantly in thalamus,heart and testis,playing a critical role in shaping the autonomous activity of single neurons and the periodocity of network oscillations
UniProtKB/Swiss-Prot EnzymeRegulation:
Activated by cAMP. cAMP binding causes a conformation change that leads to the assembly of an active tetramer and channel opening.
UniProtKB/Swiss-Prot Function:
Hyperpolarization-activated ion channel with very slow activation and inactivation exhibiting weak selectivity for potassium over sodium ions. Contributes to the native pacemaker currents in heart (If) that regulate the rhythm of heart beat. May contribute to the native pacemaker currents in neurons (Ih). May mediate responses to sour stimuli.

Phenotypes From GWAS Catalog for HCN4 Gene

Gene Ontology (GO) - Molecular Function for HCN4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005216 ion channel activity IEA --
GO:0005222 intracellular cAMP activated cation channel activity IDA 10228147
GO:0005244 voltage-gated ion channel activity IEA --
GO:0005248 voltage-gated sodium channel activity IMP 22748890
GO:0005249 voltage-gated potassium channel activity IMP 22748890
genes like me logo Genes that share ontologies with HCN4: view
genes like me logo Genes that share phenotypes with HCN4: view

Human Phenotype Ontology for HCN4 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for HCN4 Gene

MGI Knock Outs for HCN4:

Animal Model Products

  • Taconic Biosciences Mouse Models for HCN4

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for HCN4 Gene

Localization for HCN4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for HCN4 Gene

Cell membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HCN4 gene
Compartment Confidence
plasma membrane 5
cytoskeleton 1
peroxisome 1
cytosol 1

Gene Ontology (GO) - Cellular Components for HCN4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0031226 intrinsic component of plasma membrane IDA 16407510
GO:0048471 perinuclear region of cytoplasm IDA 12750403
genes like me logo Genes that share ontologies with HCN4: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for HCN4 Gene

Pathways & Interactions for HCN4 Gene

genes like me logo Genes that share pathways with HCN4: view

Pathways by source for HCN4 Gene

1 BioSystems pathway for HCN4 Gene
3 Reactome pathways for HCN4 Gene
1 PharmGKB pathway for HCN4 Gene
2 KEGG pathways for HCN4 Gene
1 Qiagen pathway for HCN4 Gene

SIGNOR curated interactions for HCN4 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for HCN4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002027 regulation of heart rate IEA,IMP 16407510
GO:0003254 regulation of membrane depolarization IDA 12750403
GO:0006810 transport IEA --
GO:0006811 ion transport IEA --
GO:0006812 cation transport IDA 12750403
genes like me logo Genes that share ontologies with HCN4: view

Drugs & Compounds for HCN4 Gene

(15) Drugs for HCN4 Gene - From: ClinicalTrials, ApexBio, DGIdb, IUPHAR, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
ivabradine Approved Pharma Antagonist, Pore Blocker 0
cyclic amp Experimental Pharma 0
cilobradine Pharma Antagonist, Pore Blocker 0
Cs<sup>+</sup> Pharma Antagonist, Pore Blocker 0
EC18 Pharma Pore Blocker 0

(1) Additional Compounds for HCN4 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • Sodium
  • Sodium ion

(2) ApexBio Compounds for HCN4 Gene

Compound Action Cas Number
Zatebradine hydrochloride 91940-87-3
ZD 7288 HCN channel inhibitor 133059-99-1
genes like me logo Genes that share compounds with HCN4: view

Drug Products

Transcripts for HCN4 Gene

mRNA/cDNA for HCN4 Gene

(2) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(42) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HCN4 Gene

Hyperpolarization activated cyclic nucleotide-gated potassium channel 4:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for HCN4 Gene

No ASD Table

Relevant External Links for HCN4 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for HCN4 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HCN4 Gene

mRNA differential expression in normal tissues according to GTEx for HCN4 Gene

This gene is overexpressed in Heart - Atrial Appendage (x16.3), Testis (x12.2), and Heart - Left Ventricle (x9.1).

Protein differential expression in normal tissues from HIPED for HCN4 Gene

This gene is overexpressed in Lung (30.2), Plasma (13.2), Peripheral blood mononuclear cells (12.5), and Frontal cortex (8.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for HCN4 Gene

Protein tissue co-expression partners for HCN4 Gene

NURSA nuclear receptor signaling pathways regulating expression of HCN4 Gene:


SOURCE GeneReport for Unigene cluster for HCN4 Gene:


mRNA Expression by UniProt/SwissProt for HCN4 Gene:

Tissue specificity: Highly expressed in thalamus, testis and in heart, both in ventricle and atrium. Detected at much lower levels in amygdala, substantia nigra, cerebellum and hippocampus.

Evidence on tissue expression from TISSUES for HCN4 Gene

  • Heart(4.6)
  • Nervous system(4.5)
  • Muscle(2.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for HCN4 Gene

Germ Layers:
  • ectoderm
  • mesoderm
  • cardiovascular
  • nervous
  • skeleton
Head and neck:
  • brain
  • cranial nerve
  • ear
  • eye
  • head
  • sinus
  • skull
  • heart
  • heart valve
  • blood
  • blood vessel
  • peripheral nervous system
  • red blood cell
genes like me logo Genes that share expression patterns with HCN4: view

Orthologs for HCN4 Gene

This gene was present in the common ancestor of animals.

Orthologs for HCN4 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia HCN4 33 34
  • 98.98 (n)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 97 (a)
-- 34
  • 97 (a)
-- 34
  • 94 (a)
(Canis familiaris)
Mammalia HCN4 34
  • 93 (a)
(Bos Taurus)
Mammalia HCN4 33 34
  • 90.69 (n)
(Rattus norvegicus)
Mammalia Hcn4 33
  • 89.28 (n)
(Mus musculus)
Mammalia Hcn4 33 16 34
  • 89.18 (n)
(Monodelphis domestica)
Mammalia HCN4 34
  • 82 (a)
(Gallus gallus)
Aves HCN4 33 34
  • 73.88 (n)
(Anolis carolinensis)
Reptilia HCN4 34
  • 72 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia hcn4 33
  • 70.95 (n)
(Danio rerio)
Actinopterygii hcn4l 33 34
  • 73.63 (n)
hcn4 34
  • 64 (a)
fruit fly
(Drosophila melanogaster)
Insecta Ih 35 34
  • 54 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 50 (a)
Species where no ortholog for HCN4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for HCN4 Gene

Gene Tree for HCN4 (if available)
Gene Tree for HCN4 (if available)

Paralogs for HCN4 Gene

Paralogs for HCN4 Gene

(3) SIMAP similar genes for HCN4 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with HCN4: view

Variants for HCN4 Gene

Sequence variations from dbSNP and Humsavar for HCN4 Gene

SNP ID Clin Chr 15 pos Variation AA Info Type
rs104894485 pathogenic, Sick sinus syndrome 2, autosomal dominant, Sick sinus syndrome 2 (SSS2) [MIM:163800] 73,325,378(-) C/T coding_sequence_variant, missense_variant
rs104894488 likely-benign, pathogenic, Brugada syndrome 8, Sick sinus syndrome 2, autosomal dominant, Sick sinus syndrome 2 (SSS2) [MIM:163800] 73,324,216(-) G/A/T coding_sequence_variant, missense_variant, synonymous_variant
rs1050326641 uncertain-significance, Brugada syndrome 8 73,322,831(-) C/T coding_sequence_variant, missense_variant
rs1057519015 pathogenic, Sick sinus syndrome 2, autosomal dominant 73,325,404(-) GGG/GG coding_sequence_variant, frameshift
rs1057519274 pathogenic, Sick sinus syndrome 2, autosomal dominant 73,325,001(-) GGTGAGCACGCTG/GGTGAGCACGCTGGGTGAGCACGCTG coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for HCN4 Gene

Variant ID Type Subtype PubMed ID
dgv4619n54 CNV loss 21841781
dgv4620n54 CNV gain 21841781
dgv4621n54 CNV gain+loss 21841781
dgv4622n54 CNV loss 21841781
esv28407 CNV loss 19812545
esv998986 CNV insertion 20482838
nsv1118319 CNV deletion 24896259
nsv1121512 CNV deletion 24896259
nsv524049 CNV loss 19592680
nsv569949 CNV loss 21841781
nsv569954 CNV gain 21841781
nsv569955 CNV loss 21841781
nsv569966 CNV loss 21841781
nsv569967 CNV gain 21841781
nsv569968 CNV loss 21841781
nsv569969 CNV loss 21841781

Variation tolerance for HCN4 Gene

Residual Variation Intolerance Score: 7.35% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.57; 56.01% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HCN4 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HCN4 Gene

Disorders for HCN4 Gene

MalaCards: The human disease database

(16) MalaCards diseases for HCN4 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
sick sinus syndrome 2
  • sss2
brugada syndrome 8
  • brgda8
familial sick sinus syndrome
  • familial sinus node dysfunction
brugada syndrome
  • bangungut
sick sinus syndrome
  • sinus node infection
- elite association - COSMIC cancer census association via MalaCards
Search HCN4 in MalaCards View complete list of genes associated with diseases


  • Brugada syndrome 8 (BRGDA8) [MIM:613123]: A tachyarrhythmia characterized by right bundle branch block and ST segment elevation on an electrocardiogram (ECG). It can cause the ventricles to beat so fast that the blood is prevented from circulating efficiently in the body. When this situation occurs, the individual will faint and may die in a few minutes if the heart is not reset. {ECO:0000269 PubMed:19165230}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Sick sinus syndrome 2 (SSS2) [MIM:163800]: The term sick sinus syndrome encompasses a variety of conditions caused by sinus node dysfunction. The most common clinical manifestations are syncope, presyncope, dizziness, and fatigue. Electrocardiogram typically shows sinus bradycardia, sinus arrest, and/or sinoatrial block. Episodes of atrial tachycardias coexisting with sinus bradycardia (tachycardia-bradycardia syndrome) are also common in this disorder. SSS occurs most often in the elderly associated with underlying heart disease or previous cardiac surgery, but can also occur in the fetus, infant, or child without heart disease or other contributing factors. SSS2 onset is in utero or at birth. {ECO:0000269 PubMed:15123648, ECO:0000269 PubMed:16407510, ECO:0000269 PubMed:20662977, ECO:0000269 PubMed:23103389}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for HCN4

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with HCN4: view

No data available for Genatlas for HCN4 Gene

Publications for HCN4 Gene

  1. Role of HCN4 channel in preventing ventricular arrhythmia. (PMID: 19165230) Ueda K … Kimura A (Journal of human genetics 2009) 3 4 22 58
  2. Two pacemaker channels from human heart with profoundly different activation kinetics. (PMID: 10228147) Ludwig A … Biel M (The EMBO journal 1999) 2 3 4 58
  3. Molecular characterization of a slowly gating human hyperpolarization-activated channel predominantly expressed in thalamus, heart, and testis. (PMID: 10430953) Seifert R … Kaupp UB (Proceedings of the National Academy of Sciences of the United States of America 1999) 2 3 4 58
  4. Local and global interpretations of a disease-causing mutation near the ligand entry path in hyperpolarization-activated cAMP-gated channel. (PMID: 23103389) Xu X … Zhou L (Structure (London, England : 1993) 2012) 3 4 58
  5. Tetramerization dynamics of C-terminal domain underlies isoform-specific cAMP gating in hyperpolarization-activated cyclic nucleotide-gated channels. (PMID: 22006928) Lolicato M … Moroni A (The Journal of biological chemistry 2011) 3 4 58

Products for HCN4 Gene

Sources for HCN4 Gene

Loading form....