There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, ... See more...

Aliases for H6PD Gene

Aliases for H6PD Gene

  • Hexose-6-Phosphate Dehydrogenase/Glucose 1-Dehydrogenase 2 3 5
  • GDH/6PGL Endoplasmic Bifunctional Protein 2 3 4
  • 6-Phosphogluconolactonase 2 3
  • Glucose Dehyrogenase 2 3
  • GDH 3 4
  • Hexose-6-Phosphate Dehydrogenase (Glucose 1-Dehydrogenase) 2
  • Glucose-6-Phosphate Dehydrogenase, Salivary 3
  • Glucose 1- Dehydrogenase 3
  • Glucose Dehydrogenase 3
  • G6PD, H Form 3
  • EC 1.1.1.49 54
  • EC 3.1.1.31 54
  • EC 2.7.4.3 54
  • CORTRD1 3
  • G6PDH 3

External Ids for H6PD Gene

Previous HGNC Symbols for H6PD Gene

  • GDH

Previous GeneCards Identifiers for H6PD Gene

  • GC01P008915
  • GC01P009105
  • GC01P009004
  • GC01P009229
  • GC01P009294
  • GC01P008445

Summaries for H6PD Gene

Entrez Gene Summary for H6PD Gene

  • There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]

GeneCards Summary for H6PD Gene

H6PD (Hexose-6-Phosphate Dehydrogenase/Glucose 1-Dehydrogenase) is a Protein Coding gene. Diseases associated with H6PD include Cortisone Reductase Deficiency 1 and Hyperandrogenism Due To Cortisone Reductase Deficiency. Among its related pathways are Carbon metabolism and Pentose phosphate pathway. Gene Ontology (GO) annotations related to this gene include carbohydrate binding and glucose-6-phosphate dehydrogenase activity. An important paralog of this gene is G6PD.

UniProtKB/Swiss-Prot Summary for H6PD Gene

  • Oxidizes glucose-6-phosphate and glucose, as well as other hexose-6-phosphates.

Gene Wiki entry for H6PD Gene

Additional gene information for H6PD Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for H6PD Gene

Genomics for H6PD Gene

GeneHancer (GH) Regulatory Elements for H6PD Gene

Promoters and enhancers for H6PD Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01J009232 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 782.7 -0.1 -74 4.2 ZBTB40 CTCF LCORL FOXA1 MLX RBPJ SMARCE1 POLR2A NR2F1 NR2F6 H6PD lnc-GPR157-5 RERE GPR157 PIK3CD-AS2 MIR34AHG RERE-AS1 SLC2A5 piR-57460-005
GH01J009237 Promoter/Enhancer 2 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 767.7 +7.1 7052 8.2 FOXA1 RBPJ NR2F1 NR2F6 MYC HLF RAD21 MAX ZNF652 ZNF148 H6PD HSALNG0000688 GPR157 MIR34A RF00017-039
GH01J009588 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE CraniofacialAtlas 14.8 +354.6 354626 2.8 CTCF ZBTB6 POLR2A MYC NFYC L3MBTL2 MNT NKRF ELF3 ZFX TMEM201 H6PD PIK3CD-AS2 SLC25A33 MIR34AHG GPR157 lnc-CLSTN1-7
GH01J009625 Promoter/Enhancer 1.8 EPDnew FANTOM5 ENCODE dbSUPER 14.8 +394.0 393986 6 ZNF24 SP1 ZBTB40 CTCF ZBTB6 RBPJ SMARCE1 HCFC1 MIXL1 RUNX1 PIK3CD LOC105376712 H6PD PIK3CD-AS2 SLC25A33 RERE MIR34AHG GPR157 DFFA TMEM201
GH01J009537 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE CraniofacialAtlas 11.8 +304.7 304712 4.6 SP1 ZBTB6 FOXA1 MLX RBPJ SMARCE1 POLR2A USF2 NR2F6 ATF1 SLC25A33 SPSB1 H6PD TMEM201 piR-34822-002
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around H6PD on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the H6PD gene promoter:
  • c-Myc
  • ER-alpha
  • GCNF
  • GCNF-1
  • Ik-1
  • Max
  • NF-1
  • RORalpha2
  • Spz1

Genomic Locations for H6PD Gene

Genomic Locations for H6PD Gene
chr1:9,234,775-9,271,337
(GRCh38/hg38)
Size:
36,563 bases
Orientation:
Plus strand
chr1:9,294,834-9,331,396
(GRCh37/hg19)
Size:
36,563 bases
Orientation:
Plus strand

Genomic View for H6PD Gene

Genes around H6PD on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H6PD Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H6PD Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for H6PD Gene

Proteins for H6PD Gene

  • Protein details for H6PD Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O95479-G6PE_HUMAN
    Recommended name:
    GDH/6PGL endoplasmic bifunctional protein
    Protein Accession:
    O95479
    Secondary Accessions:
    • Q4TT33
    • Q66I35
    • Q68DT3

    Protein attributes for H6PD Gene

    Size:
    791 amino acids
    Molecular mass:
    88893 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=CAH18137.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for H6PD Gene

Selected DME Specific Peptides for H6PD Gene

O95479:
  • RWEGVPF
  • HTASLFP
  • PLSDYYA

Post-translational modifications for H6PD Gene

  • Glycosylation at Asn157, Asn282, and Asn683
  • Modification sites at PhosphoSitePlus
  • Glycosylation from GlyConnect

Other Protein References for H6PD Gene

Domains & Families for H6PD Gene

Gene Families for H6PD Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted secreted proteins

Suggested Antigen Peptide Sequences for H6PD Gene

GenScript: Design optimal peptide antigens:
  • GDH/6PGL endoplasmic bifunctional protein (G6PE_HUMAN)
  • Uridine diphospho-glucose dehydrogenase (Q9NQ81_HUMAN)
  • Uridine diphospho-glucose dehydrogenase (Q9NQ82_HUMAN)
  • Uridine diphospho-glucose dehydrogenase (Q9NQ83_HUMAN)

Graphical View of Domain Structure for InterPro Entry

O95479

UniProtKB/Swiss-Prot:

G6PE_HUMAN :
  • In the N-terminal section; belongs to the glucose-6-phosphate dehydrogenase family.
Family:
  • In the N-terminal section; belongs to the glucose-6-phosphate dehydrogenase family.
  • In the C-terminal section; belongs to the glucosamine/galactosamine-6-phosphate isomerase family. 6-phosphogluconolactonase subfamily.
genes like me logo Genes that share domains with H6PD: view

Function for H6PD Gene

Molecular function for H6PD Gene

UniProtKB/Swiss-Prot Function:
Oxidizes glucose-6-phosphate and glucose, as well as other hexose-6-phosphates.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=D-glucose + NAD(+) = D-glucono-1,5-lactone + H(+) + NADH; Xref=Rhea:RHEA:14293, ChEBI:CHEBI:4167, ChEBI:CHEBI:15378, ChEBI:CHEBI:16217, ChEBI:CHEBI:57540, ChEBI:CHEBI:57945; EC=1.1.1.47; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=D-glucose + NADP(+) = D-glucono-1,5-lactone + H(+) + NADPH; Xref=Rhea:RHEA:14405, ChEBI:CHEBI:4167, ChEBI:CHEBI:15378, ChEBI:CHEBI:16217, ChEBI:CHEBI:57783, ChEBI:CHEBI:58349; EC=1.1.1.47; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=D-glucose 6-phosphate + NAD(+) = 6-phospho-D-glucono-1,5-lactone + H(+) + NADH; Xref=Rhea:RHEA:38215, ChEBI:CHEBI:15378, ChEBI:CHEBI:57540, ChEBI:CHEBI:57945, ChEBI:CHEBI:57955, ChEBI:CHEBI:61548; EC=1.1.1.363;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=D-glucose 6-phosphate + NADP(+) = 6-phospho-D-glucono-1,5-lactone + H(+) + NADPH; Xref=Rhea:RHEA:15841, ChEBI:CHEBI:15378, ChEBI:CHEBI:57783, ChEBI:CHEBI:57955, ChEBI:CHEBI:58349, ChEBI:CHEBI:61548; EC=1.1.1.363;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=6-phospho-D-glucono-1,5-lactone + H2O = 6-phospho-D-gluconate + H(+); Xref=Rhea:RHEA:12556, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:57955, ChEBI:CHEBI:58759; EC=3.1.1.31;.

Enzyme Numbers (IUBMB) for H6PD Gene

Phenotypes From GWAS Catalog for H6PD Gene

Gene Ontology (GO) - Molecular Function for H6PD Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004345 glucose-6-phosphate dehydrogenase activity IEA --
GO:0016491 oxidoreductase activity IEA --
GO:0016614 oxidoreductase activity, acting on CH-OH group of donors IEA --
GO:0016787 hydrolase activity IEA --
GO:0017057 6-phosphogluconolactonase activity IEA --
genes like me logo Genes that share ontologies with H6PD: view
genes like me logo Genes that share phenotypes with H6PD: view

Human Phenotype Ontology for H6PD Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for H6PD Gene

MGI Knock Outs for H6PD:
  • H6pd H6pd<tm1Pmst>
  • H6pd H6pd<tm1a(EUCOMM)Wtsi>

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H6PD

No data available for Transcription Factor Targets and HOMER Transcription for H6PD Gene

Localization for H6PD Gene

Subcellular locations from UniProtKB/Swiss-Prot for H6PD Gene

Endoplasmic reticulum lumen. Note=Microsomes, endoplasmic reticulum lumen.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for H6PD gene
Compartment Confidence
endoplasmic reticulum 5
cytosol 2
extracellular 1
mitochondrion 1
peroxisome 1
nucleus 1
plasma membrane 0
lysosome 0

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for H6PD Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005739 mitochondrion IEA --
GO:0005783 endoplasmic reticulum IEA --
GO:0005788 endoplasmic reticulum lumen IEA --
GO:0043231 intracellular membrane-bounded organelle IEA --
genes like me logo Genes that share ontologies with H6PD: view

Pathways & Interactions for H6PD Gene

PathCards logo

SuperPathways for H6PD Gene

genes like me logo Genes that share pathways with H6PD: view

Pathways by source for H6PD Gene

Gene Ontology (GO) - Biological Process for H6PD Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005975 carbohydrate metabolic process IEA --
GO:0006006 glucose metabolic process IEA --
GO:0006098 pentose-phosphate shunt IEA --
GO:0006739 NADP metabolic process IEA --
GO:0008152 metabolic process IEA --
genes like me logo Genes that share ontologies with H6PD: view

No data available for SIGNOR curated interactions for H6PD Gene

Drugs & Compounds for H6PD Gene

(47) Drugs for H6PD Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
NADH Approved Nutra Target 0
Gluconolactone Approved, Experimental Pharma 0
Magnesium Approved, Experimental, Investigational Pharma 0
Water Approved Pharma 0
Glucose 6-phosphate Experimental Pharma 0

(55) Additional Compounds for H6PD Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
nadph
  • 2'-(Dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) adenosine 5'-ester with 1,4-dihydro-1-b-D-ribofuranosylnicotinamide
  • 2'-(Dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) adenosine 5'-ester with 1,4-dihydro-1-beta-delta-ribofuranosylnicotinamide
  • Adenosine 5'-(trihydrogen diphosphate) 2'-(dihydrogen phosphate) p'-5'-ester with 1,4-dihydro-1-beta-D-ribofuranosyl-3-pyridinecarboxamide
  • Adenosine 5'-(trihydrogen diphosphate) 2'-(dihydrogen phosphate) p'-5'-ester with 1,4-dihydro-1-beta-delta-ribofuranosyl-3-pyridinecarboxamide
  • b-NADPH
53-57-6
6-Phosphonoglucono-D-lactone
  • 6-phospho-D-glucono-1,5-Lactone
  • 6-phosphonoglucono-delta-Lactone
  • [(2R,3S,4S,5R)-3,4,5-Trihydroxy-6-oxotetrahydro-2H-pyran-2-yl]methyl dihydrogen phosphate
  • D-Gluconic acid, delta-lactone, 6-(dihydrogen phosphate)
  • D-glucono-1,5-Lactone 6-phosphate
2641-81-8
Hydrogen Ion
  • H+
  • H(+)
  • Hydrogen cation
  • Hydron
  • Proton
NADP
  • beta-Nicotinamide adenine dinucleotide phosphate
  • NADP+
  • Nicotinamide adenine dinucleotide phosphate
  • Oxidized nicotinamide-adenine dinucleotide phosphate
  • TPN
53-59-8
genes like me logo Genes that share compounds with H6PD: view

Transcripts for H6PD Gene

mRNA/cDNA for H6PD Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H6PD

Alternative Splicing Database (ASD) splice patterns (SP) for H6PD Gene

No ASD Table

Relevant External Links for H6PD Gene

GeneLoc Exon Structure for
H6PD
ECgene alternative splicing isoforms for
H6PD

Expression for H6PD Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for H6PD Gene

mRNA differential expression in normal tissues according to GTEx for H6PD Gene

This gene is overexpressed in Liver (x5.4).

Protein differential expression in normal tissues from HIPED for H6PD Gene

This gene is overexpressed in Liver (8.3), Ovary (6.0), and Serum (6.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for H6PD Gene



Protein tissue co-expression partners for H6PD Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of H6PD Gene:

H6PD

SOURCE GeneReport for Unigene cluster for H6PD Gene:

Hs.463511

mRNA Expression by UniProt/SwissProt for H6PD Gene:

O95479-G6PE_HUMAN
Tissue specificity: Present in most tissues examined, strongest in liver.

Evidence on tissue expression from TISSUES for H6PD Gene

  • Liver(4.6)
  • Bone marrow(4.1)
  • Adrenal gland(2.6)

Phenotype-based relationships between genes and organs from Gene ORGANizer for H6PD Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • integumentary
  • nervous
  • reproductive
Regions:
Head and neck:
  • brain
  • face
  • head
  • pituitary gland
Pelvis:
  • ovary
  • testicle
  • uterus
General:
  • hair
  • skin
genes like me logo Genes that share expression patterns with H6PD: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for H6PD Gene

Orthologs for H6PD Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for H6PD Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia H6PD 33 32
  • 99.09 (n)
OneToOne
dog
(Canis familiaris)
Mammalia H6PD 33 32
  • 86.84 (n)
OneToOne
mouse
(Mus musculus)
Mammalia H6pd 17 33 32
  • 83.8 (n)
rat
(Rattus norvegicus)
Mammalia H6pd 32
  • 83.33 (n)
cow
(Bos Taurus)
Mammalia H6PD 33
  • 83 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 33
  • 81 (a)
OneToMany
-- 33
  • 77 (a)
OneToMany
-- 33
  • 70 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia H6PD 33
  • 74 (a)
OneToOne
chicken
(Gallus gallus)
Aves H6PD 33 32
  • 70.61 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia H6PD 33
  • 64 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia h6pd 32
  • 60.2 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.30186 32
zebrafish
(Danio rerio)
Actinopterygii h6pd 33 32
  • 56.51 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG7140 33
  • 23 (a)
OneToOne
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes ZWF1 33
  • 28 (a)
OneToMany
Species where no ortholog for H6PD was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for H6PD Gene

ENSEMBL:
Gene Tree for H6PD (if available)
TreeFam:
Gene Tree for H6PD (if available)
Aminode:
Evolutionary constrained regions (ECRs) for H6PD: view image

Paralogs for H6PD Gene

Paralogs for H6PD Gene

(2) SIMAP similar genes for H6PD Gene using alignment to 2 proteins:

  • G6PE_HUMAN
  • R4GMU1_HUMAN
genes like me logo Genes that share paralogs with H6PD: view

Variants for H6PD Gene

Sequence variations from dbSNP and Humsavar for H6PD Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs387907167 pathogenic, Cortisone reductase deficiency 1 9,263,569(+) G/A coding_sequence_variant, missense_variant
rs398122816 pathogenic, Cortisone reductase deficiency 1 9,262,273(+) G/A coding_sequence_variant, intron_variant, synonymous_variant
rs398122817 pathogenic, Cortisone reductase deficiency 1 9,262,261(+) C/G 5_prime_UTR_variant, coding_sequence_variant, stop_gained
rs398122818 pathogenic, Cortisone reductase deficiency 1 9,245,258(+) CC/C 5_prime_UTR_variant, coding_sequence_variant, frameshift
rs606231222 pathogenic, Cortisone reductase deficiency 1 9,264,354(+) /ACAGGTGGTTGACCTGTGGCCGGGTCTGA coding_sequence_variant, inframe_indel, stop_gained

Structural Variations from Database of Genomic Variants (DGV) for H6PD Gene

Variant ID Type Subtype PubMed ID
dgv12e212 CNV gain 25503493
dgv13e212 CNV gain 25503493
dgv16n100 CNV gain 25217958
dgv17n100 CNV gain 25217958
dgv2e55 CNV gain 17911159
dgv3n27 CNV gain 19166990
dgv40e59 CNV duplication 20981092
dgv96n54 CNV gain 21841781
dgv97n54 CNV gain 21841781
esv23318 CNV loss 19812545
esv2743563 CNV deletion 23290073
esv2750845 CNV gain 17911159
esv2763409 CNV gain 21179565
esv3585168 CNV gain 21293372
nsv1075364 CNV duplication 25765185
nsv1122293 CNV deletion 24896259
nsv1128586 CNV duplication 24896259
nsv1139468 CNV duplication 24896259
nsv1143434 CNV deletion 24896259
nsv1147163 CNV duplication 26484159
nsv520191 CNV gain 19592680
nsv545350 CNV gain 21841781
nsv832092 CNV loss 17160897

Variation tolerance for H6PD Gene

Residual Variation Intolerance Score: 98.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.66; 89.19% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for H6PD Gene

Human Gene Mutation Database (HGMD)
H6PD
SNPedia medical, phenotypic, and genealogical associations of SNPs for
H6PD

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for H6PD Gene

Disorders for H6PD Gene

MalaCards: The human disease database

(9) MalaCards diseases for H6PD Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
cortisone reductase deficiency 1
  • cortrd1
hyperandrogenism due to cortisone reductase deficiency
  • 11-beta-hydroxysteroid dehydrogenase deficiency type 1
cortisone reductase deficiency
  • cortrd
plantar wart
  • verruca plantaris
parotitis
- elite association - COSMIC cancer census association via MalaCards
Search H6PD in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

G6PE_HUMAN
  • Cortisone reductase deficiency 1 (CORTRD1) [MIM:604931]: An autosomal recessive error of cortisone metabolism characterized by a failure to regenerate cortisol from cortisone, resulting in increased cortisol clearance, activation of the hypothalamic- pituitary axis and ACTH-mediated adrenal androgen excess. Clinical features include hyperandrogenism resulting in hirsutism, oligo- amenorrhea, and infertility in females and premature pseudopuberty in males. {ECO:0000269 PubMed:12858176, ECO:0000269 PubMed:23132696}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for H6PD

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with H6PD: view

No data available for Genatlas for H6PD Gene

Publications for H6PD Gene

  1. Human hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) encoded at 1p36: coding sequence and expression. (PMID: 10349511) Mason PJ … Vulliamy TJ (Blood cells, molecules & diseases 1999) 2 3 4 23 56
  2. Hexose-6-phosphate dehydrogenase: a new risk gene for multiple sclerosis. (PMID: 19935835) Alcina A … Matesanz F (European journal of human genetics : EJHG 2010) 3 23 43 56
  3. Lack of Association of the 11beta-hydroxysteroid dehydrogenase type 1 gene 83,557insA and hexose-6-phosphate dehydrogenase gene R453Q polymorphisms with body composition, adrenal androgen production, blood pressure, glucose metabolism, and dementia. (PMID: 17062770) Smit P … Lamberts SW (The Journal of clinical endocrinology and metabolism 2007) 3 23 43 56
  4. Genotypes at 11beta-hydroxysteroid dehydrogenase type 11B1 and hexose-6-phosphate dehydrogenase loci are not risk factors for apparent cortisone reductase deficiency in a large population-based sample. (PMID: 16091483) White PC (The Journal of clinical endocrinology and metabolism 2005) 3 23 43 56
  5. A study of the hexose-6-phosphate dehydrogenase gene R453Q and 11beta-hydroxysteroid dehydrogenase type 1 gene 83557insA polymorphisms in the polycystic ovary syndrome. (PMID: 15827106) San Millán JL … Escobar-Morreale HF (The Journal of clinical endocrinology and metabolism 2005) 3 23 43 56

Products for H6PD Gene

Sources for H6PD Gene