Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and ... See more...

Aliases for H4C6 Gene

Aliases for H4C6 Gene

  • H4 Clustered Histone 6 2 3
  • Histone Cluster 1 H4 Family Member F 2 3 5
  • H4 Histone Family, Member C 2 3
  • Histone Cluster 1, H4f 2 3
  • Histone 1, H4f 2 3
  • HIST1H4F 3 5
  • H4/C 3 4
  • H4FC 3 4
  • Histone H4 3
  • HIST2H4 4
  • H4/A 4
  • H4/B 4
  • H4/D 4
  • H4/E 4
  • H4/G 4
  • H4/H 4
  • H4/I 4
  • H4/J 4
  • H4/K 4
  • H4/M 4
  • H4/N 4
  • H4/O 4
  • H4F2 4
  • H4FA 4
  • H4FB 4
  • H4FD 4
  • H4FE 4
  • H4FG 4
  • H4FH 4
  • H4FI 4
  • H4FJ 4
  • H4FK 4
  • H4FM 4
  • H4FN 4
  • H4FO 4
  • H4 3

External Ids for H4C6 Gene

Previous HGNC Symbols for H4C6 Gene

  • H4FC
  • HIST1H4F

Summaries for H4C6 Gene

Entrez Gene Summary for H4C6 Gene

  • Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]

GeneCards Summary for H4C6 Gene

H4C6 (H4 Clustered Histone 6) is a Protein Coding gene. Among its related pathways are DNA Double-Strand Break Repair and Cellular Senescence (REACTOME). An important paralog of this gene is H4C2.

UniProtKB/Swiss-Prot Summary for H4C6 Gene

  • Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Gene Wiki entry for H4C6 Gene

Additional gene information for H4C6 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for H4C6 Gene

Genomics for H4C6 Gene

GeneHancer (GH) Regulatory Elements for H4C6 Gene

Promoters and enhancers for H4C6 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06J026239 Promoter/Enhancer 1.6 Ensembl ENCODE CraniofacialAtlas 750.6 +1.7 1749 5.3 PPP1R10 POLR2A ETV6 CEBPB SP1 NKRF MLLT1 ZNF687 CREM CEBPG H4C6 ABT1 HMGN4 ENSG00000218690 H3C6 BTN2A1 ZNF322 H4C7
GH06J026120 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 2 -116.1 -116082 8.5 PPP1R10 GTF3C2 SIN3A ZBTB40 SP1 SREBF1 ZBTB6 LCORL FOXA1 RBPJ H2AC6 H2BC4 piR-40096 piR-31751 piR-50446 ABT1 BTN2A3P HMGN4 BTN2A1 BTN2A2
GH06J026245 Enhancer 0.3 Ensembl 0.6 +4.9 4875 0.2 MCM3 H4C7 BTN2A3P HMGN4 ABT1 ZNF322 BTN2A1 LINC00240 H4C6
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around H4C6 on UCSC Golden Path with GeneCards custom track

Genomic Locations for H4C6 Gene

Genomic Locations for H4C6 Gene
368 bases
Plus strand
461 bases
Plus strand

Genomic View for H4C6 Gene

Genes around H4C6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H4C6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H4C6 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for H4C6 Gene

Proteins for H4C6 Gene

  • Protein details for H4C6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Histone H4
    Protein Accession:
    Secondary Accessions:
    • A2VCL0
    • P02304
    • P02305
    • Q6DRA9
    • Q6FGB8
    • Q6NWP7

    Protein attributes for H4C6 Gene

    103 amino acids
    Molecular mass:
    11367 Da
    Quaternary structure:
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
    • Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for H4C6 Gene

neXtProt entry for H4C6 Gene

Post-translational modifications for H4C6 Gene

  • Acetylation at Lys-6 (H4K5ac), Lys-9 (H4K8ac), Lys-13 (H4K12ac) and Lys-17 (H4K16ac) occurs in coding regions of the genome but not in heterochromatin.
  • Citrullination at Arg-4 (H4R3ci) by PADI4 impairs methylation.
  • Monomethylation and asymmetric dimethylation at Arg-4 (H4R3me1 and H4R3me2a, respectively) by PRMT1 favors acetylation at Lys-9 (H4K8ac) and Lys-13 (H4K12ac). Demethylation is performed by JMJD6. Symmetric dimethylation on Arg-4 (H4R3me2s) by the PRDM1/PRMT5 complex may play a crucial role in the germ-cell lineage.
  • Monomethylated, dimethylated or trimethylated at Lys-21 (H4K20me1, H4K20me2, H4K20me3). Monomethylation is performed by SET8. Trimethylation is performed by KMT5B and KMT5C and induces gene silencing.
  • Phosphorylated by PAK2 at Ser-48 (H4S47ph). This phosphorylation increases the association of H3.3-H4 with the histone chaperone HIRA, thus promoting nucleosome assembly of H3.3-H4 and inhibiting nucleosome assembly of H3.1-H4.
  • Ubiquitinated by the CUL4-DDB-RBX1 complex in response to ultraviolet irradiation. This may weaken the interaction between histones and DNA and facilitate DNA accessibility to repair proteins. Monoubiquitinated at Lys-92 of histone H4 (H4K91ub1) in response to DNA damage. The exact role of H4K91ub1 in DNA damage response is still unclear but it may function as a licensing signal for additional histone H4 post-translational modifications such as H4 Lys-21 methylation (H4K20me).
  • Sumoylated, which is associated with transcriptional repression.
  • Crotonylation (Kcr) is specifically present in male germ cells and marks testis-specific genes in post-meiotic cells, including X-linked genes that escape sex chromosome inactivation in haploid cells. Crotonylation marks active promoters and enhancers and confers resistance to transcriptional repressors. It is also associated with post-meiotically activated genes on autosomes.
  • Butyrylation of histones marks active promoters and competes with histone acetylation.
  • Ubiquitination at Lys32, Lys60, Lys78, and Lys80
  • Modification sites at PhosphoSitePlus

Other Protein References for H4C6 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for H4C6 Gene

Domains & Families for H4C6 Gene

Gene Families for H4C6 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for H4C6 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the histone H4 family.
  • Belongs to the histone H4 family.
genes like me logo Genes that share domains with H4C6: view

No data available for Suggested Antigen Peptide Sequences for H4C6 Gene

Function for H4C6 Gene

Molecular function for H4C6 Gene

UniProtKB/Swiss-Prot Function:
Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Phenotypes From GWAS Catalog for H4C6 Gene

Gene Ontology (GO) - Molecular Function for H4C6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IBA,TAS 3035717
GO:0003723 RNA binding HDA 22658674
GO:0005515 protein binding IPI 9540062
GO:0019904 protein domain specific binding IPI 22368283
GO:0046982 protein heterodimerization activity IEA --
genes like me logo Genes that share ontologies with H4C6: view
genes like me logo Genes that share phenotypes with H4C6: view

Animal Model Products

CRISPR Products

miRNA for H4C6 Gene

miRTarBase miRNAs that target H4C6

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H4C6

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for H4C6 Gene

Localization for H4C6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for H4C6 Gene

Nucleus. Chromosome.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for H4C6 gene
Compartment Confidence
nucleus 5
extracellular 4
plasma membrane 1
cytoskeleton 1
mitochondrion 1
cytosol 1

Gene Ontology (GO) - Cellular Components for H4C6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000228 nuclear chromosome IDA 14718166
GO:0000784 nuclear chromosome, telomeric region HDA 19135898
GO:0000786 nucleosome TAS 3035717
GO:0000788 nuclear nucleosome IDA 20498094
GO:0005576 extracellular region TAS --
genes like me logo Genes that share ontologies with H4C6: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for H4C6 Gene

Pathways & Interactions for H4C6 Gene

PathCards logo

SuperPathways for H4C6 Gene

SuperPathway Contained pathways
1 Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
2 DNA Double-Strand Break Repair
3 Cellular Senescence (REACTOME)
4 Chromosome Maintenance
5 Cell Cycle, Mitotic
genes like me logo Genes that share pathways with H4C6: view

Gene Ontology (GO) - Biological Process for H4C6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000183 chromatin silencing at rDNA TAS --
GO:0006303 double-strand break repair via nonhomologous end joining TAS --
GO:0006334 nucleosome assembly IBA,IDA 20498094
GO:0006335 DNA replication-dependent nucleosome assembly IDA 14718166
GO:0006336 DNA replication-independent nucleosome assembly IDA 14718166
genes like me logo Genes that share ontologies with H4C6: view

No data available for SIGNOR curated interactions for H4C6 Gene

Drugs & Compounds for H4C6 Gene

No Compound Related Data Available

Transcripts for H4C6 Gene

mRNA/cDNA for H4C6 Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(2) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H4C6

Alternative Splicing Database (ASD) splice patterns (SP) for H4C6 Gene

No ASD Table

Relevant External Links for H4C6 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for H4C6 Gene

NURSA nuclear receptor signaling pathways regulating expression of H4C6 Gene:


SOURCE GeneReport for Unigene cluster for H4C6 Gene:


Evidence on tissue expression from TISSUES for H4C6 Gene

  • Liver(4.5)
  • Nervous system(4.5)
  • Eye(4.2)
  • Blood(2.4)
  • Intestine(2.3)
  • Lung(2.2)
No Expression Related Data Available

Primer Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for H4C6 Gene

Orthologs for H4C6 Gene

This gene was present in the common ancestor of animals.

Orthologs for H4C6 Gene

Organism Taxonomy Gene Similarity Type Details
(Rattus norvegicus)
Mammalia LOC102548682 32
  • 85.11 (n)
(Mus musculus)
Mammalia Hist1h4c 32
  • 84.14 (n)
H4c3 17
(Pan troglodytes)
Mammalia LOC457262 32
  • 83.82 (n)
(Bos Taurus)
Mammalia LOC527388 32
  • 80.91 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100495622 32
  • 80.91 (n)
(Danio rerio)
Actinopterygii si:ch211-113a14.9 32
  • 81.55 (n)
fruit fly
(Drosophila melanogaster)
Insecta His4:CG31611 32
  • 81.23 (n)
Species where no ortholog for H4C6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for H4C6 Gene

Gene Tree for H4C6 (if available)
Gene Tree for H4C6 (if available)
Evolutionary constrained regions (ECRs) for H4C6: view image

Paralogs for H4C6 Gene

Paralogs for H4C6 Gene

Pseudogenes.org Pseudogenes for H4C6 Gene

genes like me logo Genes that share paralogs with H4C6: view

Variants for H4C6 Gene

Sequence variations from dbSNP and Humsavar for H4C6 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1000953750 -- 26,238,531(+) G/A upstream_transcript_variant
rs1002590317 -- 26,240,490(+) T/A coding_sequence_variant, missense_variant
rs1003877214 -- 26,241,034(+) G/A downstream_transcript_variant
rs1003985808 -- 26,241,266(+) TTTTTT/TTTTTTT downstream_transcript_variant
rs1004449198 -- 26,240,183(+) AGACCCAAACAAGGAAACAG/AG upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for H4C6 Gene

Variant ID Type Subtype PubMed ID
dgv5926n100 CNV gain 25217958
nsv1021294 CNV loss 25217958
nsv1023453 CNV gain 25217958
nsv428137 CNV loss 18775914
nsv601173 CNV loss 21841781

Variation tolerance for H4C6 Gene

Residual Variation Intolerance Score: 26.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.30; 6.72% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for H4C6 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for H4C6 Gene

Disorders for H4C6 Gene


  • Note=Chromosomal aberrations involving HISTONE H4 is a cause of B-cell non-Hodgkin lymphomas (B-cell NHL). Translocation t(3;6)(q27;p21), with BCL6. {ECO:0000269 PubMed:12414651}.

Additional Disease Information for H4C6

No disorders were found for H4C6 Gene.

No data available for MalaCards and Genatlas for H4C6 Gene

Publications for H4C6 Gene

  1. The human and mouse replication-dependent histone genes. (PMID: 12408966) Marzluff WF … Maltais LJ (Genomics 2002) 2 3 4 56
  2. Human histone gene organization: nonregular arrangement within a large cluster. (PMID: 9119399) Albig W … Doenecke D (Genomics 1997) 2 3 4 56
  3. Isolation and characterization of two human H1 histone genes within clusters of core histone genes. (PMID: 1916825) Albig W … Doenecke D (Genomics 1991) 2 3 4 56
  4. Phosphorylation of H4 Ser 47 promotes HIRA-mediated nucleosome assembly. (PMID: 21724829) Kang B … Zhang Z (Genes & development 2011) 3 4 56
  5. The human histone gene cluster at the D6S105 locus. (PMID: 9439656) Albig W … Doenecke D (Human genetics 1997) 3 4 56

Products for H4C6 Gene

Sources for H4C6 Gene