Free for academic non-profit institutions. Other users need a Commercial license
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and ... See more...
Aliases for H4C6 Gene
Aliases for H4C6 Gene
External Ids for H4C6 Gene
- HGNC: 4783
- Entrez Gene: 8361
- Ensembl: ENSG00000274618
- OMIM: 602824
- UniProtKB: P62805
Previous HGNC Symbols for H4C6 Gene
- H4FC
- HIST1H4F
Summaries for H4C6 Gene
-
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]
GeneCards Summary for H4C6 Gene
H4C6 (H4 Clustered Histone 6) is a Protein Coding gene. Among its related pathways are DNA Double-Strand Break Repair and Cellular Senescence (REACTOME). An important paralog of this gene is H4C2.
UniProtKB/Swiss-Prot Summary for H4C6 Gene
-
Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.
No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for H4C6 Gene
Genomics for H4C6 Gene
GeneHancer (GH) Regulatory Elements for H4C6 Gene
Promoters and enhancers for H4C6 Gene
| GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
|---|---|---|---|---|---|---|---|---|---|---|
| GH06J026239 | Promoter/Enhancer | 1.6 | Ensembl ENCODE CraniofacialAtlas | 750.6 | +1.7 | 1749 | 5.3 | PPP1R10 POLR2A ETV6 CEBPB SP1 NKRF MLLT1 ZNF687 CREM CEBPG | H4C6 ABT1 HMGN4 ENSG00000218690 H3C6 BTN2A1 ZNF322 H4C7 | |
| GH06J026120 | Promoter/Enhancer | 2.7 | EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER | 2 | -116.1 | -116082 | 8.5 | PPP1R10 GTF3C2 SIN3A ZBTB40 SP1 SREBF1 ZBTB6 LCORL FOXA1 RBPJ | H2AC6 H2BC4 piR-40096 piR-31751 piR-50446 ABT1 BTN2A3P HMGN4 BTN2A1 BTN2A2 | |
| GH06J026245 | Enhancer | 0.3 | Ensembl | 0.6 | +4.9 | 4875 | 0.2 | MCM3 | H4C7 BTN2A3P HMGN4 ABT1 ZNF322 BTN2A1 LINC00240 H4C6 |
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around H4C6 on UCSC Golden Path with GeneCards custom track
Genomic Locations for H4C6 Gene
Genomic Locations for H4C6 Gene
- chr6:26,240,426-26,240,793
- (GRCh38/hg38)
- Size:
- 368 bases
- Orientation:
- Plus strand
- chr6:26,240,561-26,241,021
- (GRCh37/hg19)
- Size:
- 461 bases
- Orientation:
- Plus strand
Genomic View for H4C6 Gene
Genes around H4C6 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 6p22.2 by HGNC
- 6p22.2 by Entrez Gene
- 6p22.2 by Ensembl
H4C6 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for H4C6 Gene
Proteins for H4C6 Gene
-
Protein details for H4C6 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P62805-H4_HUMAN
- Recommended name:
- Histone H4
- Protein Accession:
- P62805
- A2VCL0
- P02304
- P02305
- Q6DRA9
- Q6FGB8
- Q6NWP7
Protein attributes for H4C6 Gene
- Size:
- 103 amino acids
- Molecular mass:
- 11367 Da
- Quaternary structure:
-
- The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA.
- SequenceCaution:
-
- Sequence=AAI28106.1; Type=Frameshift; Positions=3; Evidence={ECO:0000305};
Post-translational modifications for H4C6 Gene
- Acetylation at Lys-6 (H4K5ac), Lys-9 (H4K8ac), Lys-13 (H4K12ac) and Lys-17 (H4K16ac) occurs in coding regions of the genome but not in heterochromatin.
- Citrullination at Arg-4 (H4R3ci) by PADI4 impairs methylation.
- Monomethylation and asymmetric dimethylation at Arg-4 (H4R3me1 and H4R3me2a, respectively) by PRMT1 favors acetylation at Lys-9 (H4K8ac) and Lys-13 (H4K12ac). Demethylation is performed by JMJD6. Symmetric dimethylation on Arg-4 (H4R3me2s) by the PRDM1/PRMT5 complex may play a crucial role in the germ-cell lineage.
- Monomethylated, dimethylated or trimethylated at Lys-21 (H4K20me1, H4K20me2, H4K20me3). Monomethylation is performed by SET8. Trimethylation is performed by KMT5B and KMT5C and induces gene silencing.
- Phosphorylated by PAK2 at Ser-48 (H4S47ph). This phosphorylation increases the association of H3.3-H4 with the histone chaperone HIRA, thus promoting nucleosome assembly of H3.3-H4 and inhibiting nucleosome assembly of H3.1-H4.
- Ubiquitinated by the CUL4-DDB-RBX1 complex in response to ultraviolet irradiation. This may weaken the interaction between histones and DNA and facilitate DNA accessibility to repair proteins. Monoubiquitinated at Lys-92 of histone H4 (H4K91ub1) in response to DNA damage. The exact role of H4K91ub1 in DNA damage response is still unclear but it may function as a licensing signal for additional histone H4 post-translational modifications such as H4 Lys-21 methylation (H4K20me).
- Sumoylated, which is associated with transcriptional repression.
- Crotonylation (Kcr) is specifically present in male germ cells and marks testis-specific genes in post-meiotic cells, including X-linked genes that escape sex chromosome inactivation in haploid cells. Crotonylation marks active promoters and enhancers and confers resistance to transcriptional repressors. It is also associated with post-meiotically activated genes on autosomes.
- Butyrylation of histones marks active promoters and competes with histone acetylation.
-
Ubiquitination at Lys32, Lys60, Lys78, and Lys80
- NX_P62805 (NX_P62805-1)
- Modification sites at PhosphoSitePlus
Other Protein References for H4C6 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Protein Products
-
OriGene Purified Proteins for H4C6
- Search Origene for MassSpec and Protein Over-expression Lysates for H4C6
- Origene Custom Protein Services for H4C6
- Novus Biologicals lysates for H4C6
No data available for DME Specific Peptides for H4C6 Gene
Domains & Families for H4C6 Gene
Gene Families for H4C6 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Predicted intracellular proteins
Protein Domains for H4C6 Gene
- InterPro:
- ProtoNet:
Graphical View of Domain Structure for InterPro Entry
P62805- Family:
-
- Belongs to the histone H4 family.
No data available for Suggested Antigen Peptide Sequences for H4C6 Gene
Function for H4C6 Gene
Molecular function for H4C6 Gene
- UniProtKB/Swiss-Prot Function:
- Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.
Phenotypes From GWAS Catalog for H4C6 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003677 | DNA binding | IBA,TAS | 3035717 |
| GO:0003723 | RNA binding | HDA | 22658674 |
| GO:0005515 | protein binding | IPI | 9540062 |
| GO:0019904 | protein domain specific binding | IPI | 22368283 |
| GO:0046982 | protein heterodimerization activity | IEA | -- |
Phenotypes for H4C6 Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR Products
-
OriGene CRISPR knockouts for H4C6
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for H4C6
- genomics-online: gRNA clones - Search results for available HIST1H4F gene related products
- Applied Biological Materials (abm): CRISPR Clones for H4C6 - Select products 50% OFF >
- * H4C6 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * H4C6 CRISPR applications: KO, Activation, Repression, and more - Browse All
miRNA for H4C6 Gene
- miRTarBase miRNAs that target H4C6
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for H4C6
- Browse OriGene Inhibitory RNA Products For H4C6
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H4C6
- genomics-online: shRNA clones - Search results for available HIST1H4F gene related products
Clone Products
- Sino Biological Human cDNA Clone for H4C6
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for H4C6
- genomics-online: cdna clones - Search results for available HIST1H4F gene related products
- orf clones - Search results for available HIST1H4F gene related products
- Applied Biological Materials (abm): Clones for H4C6 - Select products 50% OFF >
- * H4C6 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * H4C6 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Cell Line Products
-
Horizon Cell Lines for H4C6
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for H4C6 Gene
Localization for H4C6 Gene
Subcellular locations from UniProtKB/Swiss-Prot for H4C6 Gene
- Nucleus. Chromosome.
| Compartment | Confidence |
|---|---|
| nucleus | 5 |
| extracellular | 4 |
| plasma membrane | 1 |
| cytoskeleton | 1 |
| mitochondrion | 1 |
| cytosol | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000228 | nuclear chromosome | IDA | 14718166 |
| GO:0000784 | nuclear chromosome, telomeric region | HDA | 19135898 |
| GO:0000786 | nucleosome | TAS | 3035717 |
| GO:0000788 | nuclear nucleosome | IDA | 20498094 |
| GO:0005576 | extracellular region | TAS | -- |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for H4C6 Gene
Pathways & Interactions for H4C6 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 |
.88
|
.34
|
| 2 | DNA Double-Strand Break Repair |
.53
|
|
| 3 | Cellular Senescence (REACTOME) | ||
| 4 | Chromosome Maintenance | ||
| 5 | Cell Cycle, Mitotic |
.83
|
.60
|
Pathways by source for H4C6 Gene
2 BioSystems pathways for H4C6 Gene
66 Reactome pathways for H4C6 Gene
- Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
- Activation of anterior HOX genes in hindbrain development during early embryogenesis
- Activation of HOX genes during differentiation
- Amyloid fiber formation
- B-WICH complex positively regulates rRNA expression
3 KEGG pathways for H4C6 Gene
4 GeneGo (Thomson Reuters) pathways for H4C6 Gene
2 Qiagen pathways for H4C6 Gene
- Crosstalk Between CARM1 and ESRs
- Nuclear Receptor Activation by Vitamin-A
1 GeneTex pathway for H4C6 Gene
Interacting Proteins for H4C6 Gene
GPS-Prot Interaction Network for H4C6
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000183 | chromatin silencing at rDNA | TAS | -- |
| GO:0006303 | double-strand break repair via nonhomologous end joining | TAS | -- |
| GO:0006334 | nucleosome assembly | IBA,IDA | 20498094 |
| GO:0006335 | DNA replication-dependent nucleosome assembly | IDA | 14718166 |
| GO:0006336 | DNA replication-independent nucleosome assembly | IDA | 14718166 |
No data available for SIGNOR curated interactions for H4C6 Gene
Transcripts for H4C6 Gene
mRNA/cDNA for H4C6 Gene
- (1) REFSEQ mRNAs :
- (3) Additional mRNA sequences :
- (2) Selected AceView cDNA sequences:
- (1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000244537 312 bps (ENST00000244537.5)
CRISPR Products
-
OriGene CRISPR knockouts for H4C6
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for H4C6
- genomics-online: gRNA clones - Search results for available HIST1H4F gene related products
- Applied Biological Materials (abm): CRISPR Clones for H4C6 - Select products 50% OFF >
- * H4C6 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * H4C6 CRISPR applications: KO, Activation, Repression, and more - Browse All
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for H4C6
- Browse OriGene Inhibitory RNA Products For H4C6
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H4C6
- genomics-online: shRNA clones - Search results for available HIST1H4F gene related products
Clone Products
- Sino Biological Human cDNA Clone for H4C6
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for H4C6
- genomics-online: cdna clones - Search results for available HIST1H4F gene related products
- orf clones - Search results for available HIST1H4F gene related products
- Applied Biological Materials (abm): Clones for H4C6 - Select products 50% OFF >
- * H4C6 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * H4C6 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Expression for H4C6 Gene
NURSA nuclear receptor signaling pathways regulating expression of H4C6 Gene:
H4C6SOURCE GeneReport for Unigene cluster for H4C6 Gene:
Hs.247816Evidence on tissue expression from TISSUES for H4C6 Gene
- Liver(4.5)
- Nervous system(4.5)
- Eye(4.2)
- Blood(2.4)
- Intestine(2.3)
- Lung(2.2)
No Expression Related Data Available
Primer Products
-
OriGene qPCR primer pairs for H4C6
- genomics-online: primer clones - Search results for available HIST1H4F gene related products
No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for H4C6 Gene
Orthologs for H4C6 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| rat (Rattus norvegicus) |
Mammalia | LOC102548682 32 |
|
||
| mouse (Mus musculus) |
Mammalia | Hist1h4c 32 |
|
||
| H4c3 17 |
|
||||
| chimpanzee (Pan troglodytes) |
Mammalia | LOC457262 32 |
|
||
| cow (Bos Taurus) |
Mammalia | LOC527388 32 |
|
||
| tropical clawed frog (Silurana tropicalis) |
Amphibia | LOC100495622 32 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | si:ch211-113a14.9 32 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | His4:CG31611 32 |
|
- Species where no ortholog for H4C6 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- chicken (Gallus gallus)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- dog (Canis familiaris)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- lizard (Anolis carolinensis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- oppossum (Monodelphis domestica)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- platypus (Ornithorhynchus anatinus)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Evolution for H4C6 Gene
- ENSEMBL:
- Gene Tree for H4C6 (if available)
- TreeFam:
- Gene Tree for H4C6 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for H4C6: view image
Paralogs for H4C6 Gene
Variants for H4C6 Gene
| SNP ID | Clin | Chr 06 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1000953750 | -- | 26,238,531(+) | G/A | upstream_transcript_variant | |
| rs1002590317 | -- | 26,240,490(+) | T/A | coding_sequence_variant, missense_variant | |
| rs1003877214 | -- | 26,241,034(+) | G/A | downstream_transcript_variant | |
| rs1003985808 | -- | 26,241,266(+) | TTTTTT/TTTTTTT | downstream_transcript_variant | |
| rs1004449198 | -- | 26,240,183(+) | AGACCCAAACAAGGAAACAG/AG | upstream_transcript_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| dgv5926n100 | CNV | gain | 25217958 |
| nsv1021294 | CNV | loss | 25217958 |
| nsv1023453 | CNV | gain | 25217958 |
| nsv428137 | CNV | loss | 18775914 |
| nsv601173 | CNV | loss | 21841781 |
Residual Variation Intolerance Score:
26.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
0.30;
6.72% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for H4C6 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- H4C6
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for H4C6 Gene
Disorders for H4C6 Gene
UniProtKB/Swiss-Prot
H4_HUMAN- Note=Chromosomal aberrations involving HISTONE H4 is a cause of B-cell non-Hodgkin lymphomas (B-cell NHL). Translocation t(3;6)(q27;p21), with BCL6. {ECO:0000269 PubMed:12414651}.
Additional Disease Information for H4C6
No disorders were found for H4C6 Gene.
No data available for MalaCards and Genatlas for H4C6 Gene
Publications for H4C6 Gene
- The human and mouse replication-dependent histone genes. (PMID: 12408966) Marzluff WF … Maltais LJ (Genomics 2002) 2 3 4 56
- Human histone gene organization: nonregular arrangement within a large cluster. (PMID: 9119399) Albig W … Doenecke D (Genomics 1997) 2 3 4 56
- Isolation and characterization of two human H1 histone genes within clusters of core histone genes. (PMID: 1916825) Albig W … Doenecke D (Genomics 1991) 2 3 4 56
- Phosphorylation of H4 Ser 47 promotes HIRA-mediated nucleosome assembly. (PMID: 21724829) Kang B … Zhang Z (Genes & development 2011) 3 4 56
- The human histone gene cluster at the D6S105 locus. (PMID: 9439656) Albig W … Doenecke D (Human genetics 1997) 3 4 56
ExternalLinks
Products for H4C6 Gene
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for H4C6
- Search Origene for MassSpec and Protein Over-expression Lysates for H4C6
- Origene Custom Protein Services for H4C6
- Origene sirna, shrna, and RNAi products in human, mouse, rat for H4C6
- Browse OriGene Inhibitory RNA Products For H4C6
- OriGene qPCR primer pairs for H4C6
- OriGene CRISPR knockouts for H4C6
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For H4C6
- Sino Biological Human cDNA Clone for H4C6
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals lysates for H4C6
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Invitrogen Antibodies for H4C6 (AFLGC-HIST1H4F)
- Horizon Cell Lines for H4C6
- genomics-online: cdna clones - Search results for available HIST1H4F gene related products
- orf clones - Search results for available HIST1H4F gene related products
- genomics-online: gRNA clones - Search results for available HIST1H4F gene related products
- genomics-online: primer clones - Search results for available HIST1H4F gene related products
- genomics-online: shRNA clones - Search results for available HIST1H4F gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for H4C6
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for H4C6
- Search GeneCopoeia for miRNA 3'UTR Target clone products for H4C6
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H4C6
Sources for H4C6 Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource