Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histon... See more...

Aliases for H3C15 Gene

Aliases for H3C15 Gene

  • H3 Clustered Histone 15 2 3
  • Histone Cluster 2 H3 Family Member A 2 3 5
  • Histone Cluster 2, H3a 2 3
  • Histone 2, H3a 2 3
  • Histone H3.2 3 4
  • Histone H3/O 3 4
  • HIST2H3A 3 5
  • Histone H3/M 4
  • H3/N 3
  • H3/O 3
  • H3F2 4
  • H3FM 4

External Ids for H3C15 Gene

Previous HGNC Symbols for H3C15 Gene

  • HIST2H3A

Summaries for H3C15 Gene

Entrez Gene Summary for H3C15 Gene

  • Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Aug 2015]

GeneCards Summary for H3C15 Gene

H3C15 (H3 Clustered Histone 15) is a Protein Coding gene. Among its related pathways are Cellular Senescence (REACTOME) and Meiosis. An important paralog of this gene is H3C13.

UniProtKB/Swiss-Prot Summary for H3C15 Gene

  • Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Additional gene information for H3C15 Gene

No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for H3C15 Gene

Genomics for H3C15 Gene

GeneHancer (GH) Regulatory Elements for H3C15 Gene

Promoters and enhancers for H3C15 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01J149846 Promoter/Enhancer 1.6 Ensembl ENCODE CraniofacialAtlas dbSUPER 750.6 -1.7 -1660 8.1 PPP1R10 E2F8 SIN3A POLR2A ZBTB33 SP1 MAFK MLLT1 SP7 IKZF1 H2BC20P H2AC19 H3C15 lnc-HIST2H2AA3-1 lnc-HIST2H4B-1 piR-45268-002 PRPF3 SF3B4 H2AC20 H2BC21
GH01J149859 Promoter/Enhancer 0.8 EPDnew Ensembl dbSUPER 0.4 +8.2 8182 5.6 ENSG00000264207 H4C15 H3C15
GH01J149855 Promoter/Enhancer 0.5 Ensembl dbSUPER 0.6 +3.0 2982 0.4 H3C15 H4C15
GH01J149856 Promoter/Enhancer 0.5 Ensembl dbSUPER 0.6 +4.3 4282 1.8 H3C15 H4C15
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around H3C15 on UCSC Golden Path with GeneCards custom track

Genomic Locations for H3C15 Gene

Genomic Locations for H3C15 Gene
chr1:149,852,619-149,854,274
(GRCh38/hg38)
Size:
1,656 bases
Orientation:
Plus strand
chr1:149,824,181-149,825,836
(GRCh37/hg19)
Size:
1,656 bases
Orientation:
Plus strand

Genomic View for H3C15 Gene

Genes around H3C15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H3C15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H3C15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for H3C15 Gene

Proteins for H3C15 Gene

  • Protein details for H3C15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q71DI3-H32_HUMAN
    Recommended name:
    Histone H3.2
    Protein Accession:
    Q71DI3
    Secondary Accessions:
    • A2BDF6
    • A6NFS4
    • Q6B053

    Protein attributes for H3C15 Gene

    Size:
    136 amino acids
    Molecular mass:
    15388 Da
    Quaternary structure:
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA. During nucleosome assembly the chaperone ASF1A interacts with the histone H3-H4 heterodimer.

    Three dimensional structures from OCA and Proteopedia for H3C15 Gene

neXtProt entry for H3C15 Gene

Post-translational modifications for H3C15 Gene

  • Acetylation is generally linked to gene activation. Acetylation on Lys-10 (H3K9ac) impairs methylation at Arg-9 (H3R8me2s). Acetylation on Lys-19 (H3K18ac) and Lys-24 (H3K24ac) favors methylation at Arg-18 (H3R17me). Acetylation at Lys-123 (H3K122ac) by EP300/p300 plays a central role in chromatin structure: localizes at the surface of the histone octamer and stimulates transcription, possibly by promoting nucleosome instability.
  • Citrullination at Arg-9 (H3R8ci) and/or Arg-18 (H3R17ci) by PADI4 impairs methylation and represses transcription.
  • Asymmetric dimethylation at Arg-18 (H3R17me2a) by CARM1 is linked to gene activation. Symmetric dimethylation at Arg-9 (H3R8me2s) by PRMT5 is linked to gene repression. Asymmetric dimethylation at Arg-3 (H3R2me2a) by PRMT6 is linked to gene repression and is mutually exclusive with H3 Lys-5 methylation (H3K4me2 and H3K4me3). H3R2me2a is present at the 3' of genes regardless of their transcription state and is enriched on inactive promoters, while it is absent on active promoters.
  • Methylation at Lys-5 (H3K4me), Lys-37 (H3K36me) and Lys-80 (H3K79me) are linked to gene activation. Methylation at Lys-5 (H3K4me) facilitates subsequent acetylation of H3 and H4. Methylation at Lys-80 (H3K79me) is associated with DNA double-strand break (DSB) responses and is a specific target for TP53BP1. Methylation at Lys-10 (H3K9me) and Lys-28 (H3K27me) are linked to gene repression. Methylation at Lys-10 (H3K9me) is a specific target for HP1 proteins (CBX1, CBX3 and CBX5) and prevents subsequent phosphorylation at Ser-11 (H3S10ph) and acetylation of H3 and H4. Methylation at Lys-5 (H3K4me) and Lys-80 (H3K79me) require preliminary monoubiquitination of H2B at 'Lys-120'. Methylation at Lys-10 (H3K9me) and Lys-28 (H3K27me) are enriched in inactive X chromosome chromatin. Monomethylation at Lys-57 (H3K56me1) by EHMT2/G9A in G1 phase promotes interaction with PCNA and is required for DNA replication.
  • Phosphorylated at Thr-4 (H3T3ph) by HASPIN during prophase and dephosphorylated during anaphase. Phosphorylation at Ser-11 (H3S10ph) by AURKB is crucial for chromosome condensation and cell-cycle progression during mitosis and meiosis. In addition phosphorylation at Ser-11 (H3S10ph) by RPS6KA4 and RPS6KA5 is important during interphase because it enables the transcription of genes following external stimulation, like mitogens, stress, growth factors or UV irradiation and result in the activation of genes, such as c-fos and c-jun. Phosphorylation at Ser-11 (H3S10ph), which is linked to gene activation, prevents methylation at Lys-10 (H3K9me) but facilitates acetylation of H3 and H4. Phosphorylation at Ser-11 (H3S10ph) by AURKB mediates the dissociation of HP1 proteins (CBX1, CBX3 and CBX5) from heterochromatin. Phosphorylation at Ser-11 (H3S10ph) is also an essential regulatory mechanism for neoplastic cell transformation. Phosphorylated at Ser-29 (H3S28ph) by MAP3K20 isoform 1, RPS6KA5 or AURKB during mitosis or upon ultraviolet B irradiation. Phosphorylation at Thr-7 (H3T6ph) by PRKCB is a specific tag for epigenetic transcriptional activation that prevents demethylation of Lys-5 (H3K4me) by LSD1/KDM1A. At centromeres, specifically phosphorylated at Thr-12 (H3T11ph) from prophase to early anaphase, by DAPK3 and PKN1. Phosphorylation at Thr-12 (H3T11ph) by PKN1 is a specific tag for epigenetic transcriptional activation that promotes demethylation of Lys-10 (H3K9me) by KDM4C/JMJD2C. Phosphorylation at Tyr-42 (H3Y41ph) by JAK2 promotes exclusion of CBX5 (HP1 alpha) from chromatin.
  • Monoubiquitinated by RAG1 in lymphoid cells, monoubiquitination is required for V(D)J recombination. Ubiquitinated by the CUL4-DDB-RBX1 complex in response to ultraviolet irradiation. This may weaken the interaction between histones and DNA and facilitate DNA accessibility to repair proteins.
  • Lysine deamination at Lys-5 (H3K4all) to form allysine is mediated by LOXL2. Allysine formation by LOXL2 only takes place on H3K4me3 and results in gene repression.
  • Crotonylation (Kcr) is specifically present in male germ cells and marks testis-specific genes in post-meiotic cells, including X-linked genes that escape sex chromosome inactivation in haploid cells. Crotonylation marks active promoters and enhancers and confers resistance to transcriptional repressors. It is also associated with post-meiotically activated genes on autosomes.
  • Butyrylation of histones marks active promoters and competes with histone acetylation. It is present during late spermatogenesis.
  • Succinylation at Lys-80 (H3K79succ) by KAT2A takes place with a maximum frequency around the transcription start sites of genes (PubMed:29211711). It gives a specific tag for epigenetic transcription activation (PubMed:29211711).
  • Serine ADP-ribosylation constitutes the primary form of ADP-ribosylation of proteins in response to DNA damage (PubMed:29480802). Serine ADP-ribosylation at Ser-11 (H3S10ADPr) is mutually exclusive with phosphorylation at Ser-11 (H3S10ph) and impairs acetylation at Lys-10 (H3K9ac) (PubMed:30257210).
  • Ubiquitination at Lys116
  • Modification sites at PhosphoSitePlus

Other Protein References for H3C15 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for H3C15 Gene

Domains & Families for H3C15 Gene

Gene Families for H3C15 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for H3C15 Gene

Graphical View of Domain Structure for InterPro Entry

Q71DI3

UniProtKB/Swiss-Prot:

H32_HUMAN :
  • Belongs to the histone H3 family.
Family:
  • Belongs to the histone H3 family.
genes like me logo Genes that share domains with H3C15: view

No data available for Suggested Antigen Peptide Sequences for H3C15 Gene

Function for H3C15 Gene

Molecular function for H3C15 Gene

UniProtKB/Swiss-Prot Function:
Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Gene Ontology (GO) - Molecular Function for H3C15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IEA --
GO:0005515 protein binding IPI 20580717
GO:0031492 nucleosomal DNA binding IBA 21873635
GO:0046982 protein heterodimerization activity IEA --
genes like me logo Genes that share ontologies with H3C15: view

Phenotypes for H3C15 Gene

genes like me logo Genes that share phenotypes with H3C15: view

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for H3C15 Gene

Localization for H3C15 Gene

Subcellular locations from UniProtKB/Swiss-Prot for H3C15 Gene

Nucleus. Chromosome.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for H3C15 gene
Compartment Confidence
nucleus 5
extracellular 4

Gene Ontology (GO) - Cellular Components for H3C15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000786 nucleosome IDA,IBA 21636898
GO:0005576 extracellular region TAS --
GO:0005634 nucleus IDA,IBA 21636898
GO:0005654 nucleoplasm TAS --
GO:0005694 chromosome IEA --
genes like me logo Genes that share ontologies with H3C15: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for H3C15 Gene

Pathways & Interactions for H3C15 Gene

PathCards logo

SuperPathways for H3C15 Gene

SuperPathway Contained pathways
1 Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
2 Cellular Senescence (REACTOME)
3 Cell Cycle, Mitotic
.60
4 Chromatin organization
5 Mitotic Prophase
genes like me logo Genes that share pathways with H3C15: view

Gene Ontology (GO) - Biological Process for H3C15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000183 chromatin silencing at rDNA TAS --
GO:0006325 chromatin organization TAS --
GO:0006334 nucleosome assembly IDA 21636898
GO:0007596 blood coagulation TAS --
GO:0038111 interleukin-7-mediated signaling pathway TAS --
genes like me logo Genes that share ontologies with H3C15: view

No data available for SIGNOR curated interactions for H3C15 Gene

Drugs & Compounds for H3C15 Gene

No Compound Related Data Available

Transcripts for H3C15 Gene

mRNA/cDNA for H3C15 Gene

(1) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(5) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for H3C15 Gene

No ASD Table

Relevant External Links for H3C15 Gene

GeneLoc Exon Structure for
H3C15
ECgene alternative splicing isoforms for
H3C15

Expression for H3C15 Gene

NURSA nuclear receptor signaling pathways regulating expression of H3C15 Gene:

H3C15

SOURCE GeneReport for Unigene cluster for H3C15 Gene:

Hs.706618

Evidence on tissue expression from TISSUES for H3C15 Gene

  • Spleen(4.2)
No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for H3C15 Gene

Orthologs for H3C15 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for H3C15 Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia HIST2H3A 33
  • 100 (a)
OneToOne
LOC619141 32
  • 93.87 (n)
dog
(Canis familiaris)
Mammalia HIST2H3A 33
  • 100 (a)
OneToOne
LOC483172 32
  • 93.38 (n)
mouse
(Mus musculus)
Mammalia Hist1h3c 33
  • 100 (a)
OneToOne
Hist1h3f 32
  • 90.93 (n)
H3c7 17
chimpanzee
(Pan troglodytes)
Mammalia HIST2H3A 33
  • 100 (a)
OneToOne
LOC100613592 32
  • 77.7 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia HIST2H3A 33
  • 96 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia -- 33
  • 93 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia LOC100359421 32
  • 77.45 (n)
chicken
(Gallus gallus)
Aves H3-I 33
  • 100 (a)
ManyToMany
LOC417953 32
  • 92.16 (n)
lizard
(Anolis carolinensis)
Reptilia HIST2H3A 33
  • 100 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100487179 32
  • 85.29 (n)
zebrafish
(Danio rerio)
Actinopterygii hist2h3c 33
  • 100 (a)
OneToOne
zgc:113983 32
  • 84.31 (n)
fruit fly
(Drosophila melanogaster)
Insecta His3:CG33842 33
  • 100 (a)
OneToMany
His3:CG33824 33
  • 100 (a)
OneToMany
His3:CG33854 33
  • 100 (a)
OneToMany
His3:CG33818 33
  • 100 (a)
OneToMany
His3:CG33827 33
  • 100 (a)
OneToMany
His3:CG33860 33
  • 100 (a)
OneToMany
His3:CG33836 33
  • 100 (a)
OneToMany
His3:CG33821 33
  • 100 (a)
OneToMany
His3:CG33830 33
  • 100 (a)
OneToMany
His3:CG33848 33
  • 100 (a)
OneToMany
His3:CG33812 33
  • 100 (a)
OneToMany
His3:CG33863 33
  • 100 (a)
OneToMany
His3:CG33815 33 32
  • 81.62 (n)
OneToMany
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP012573 32
  • 85.54 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT1G13370 32
  • 70.59 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 100 (a)
OneToOne
Species where no ortholog for H3C15 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for H3C15 Gene

ENSEMBL:
Gene Tree for H3C15 (if available)
TreeFam:
Gene Tree for H3C15 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for H3C15: view image

Paralogs for H3C15 Gene

genes like me logo Genes that share paralogs with H3C15: view

Variants for H3C15 Gene

Sequence variations from dbSNP and Humsavar for H3C15 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs112446191 -- 149,851,526(+) T/G upstream_transcript_variant
rs1161617723 -- 149,850,708(+) G/A upstream_transcript_variant
rs1161887931 -- 149,851,720(+) G/A upstream_transcript_variant
rs1166121111 -- 149,851,674(+) GACGGGACGGGACGGGACGGGACGGGACGGGACGGG/GACGGGACGGGACGGGACGGGACGGG/GACGGGACGGGACGGGACGGGACGGGACGGG upstream_transcript_variant
rs1202353772 -- 149,850,628(+) A/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for H3C15 Gene

Variant ID Type Subtype PubMed ID
esv1007634 OTHER inversion 20482838
nsv46 OTHER inversion 15895083
nsv469694 CNV loss 16826518
nsv499132 OTHER inversion 21111241
nsv547843 CNV loss 21841781
nsv7182 OTHER inversion 18451855
nsv824564 CNV gain 20364138
nsv831503 CNV gain 17160897
nsv831525 CNV gain 17160897
nsv946379 CNV duplication 23825009
nsv946381 CNV duplication 23825009

Additional Variant Information for H3C15 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
H3C15

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for H3C15 Gene

Disorders for H3C15 Gene

Additional Disease Information for H3C15

No disorders were found for H3C15 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for H3C15 Gene

Publications for H3C15 Gene

  1. Functional characterization of a human histone gene cluster duplication. (PMID: 15527963) Braastad CD … Stein GS (Gene 2004) 2 3 4 56
  2. The human and mouse replication-dependent histone genes. (PMID: 12408966) Marzluff WF … Maltais LJ (Genomics 2002) 2 3 4 56
  3. Arginine methylation of the histone H3 tail impedes effector binding. (PMID: 18077460) Iberg AN … Bedford MT (The Journal of biological chemistry 2008) 3 4 56
  4. Organismal differences in post-translational modifications in histones H3 and H4. (PMID: 17194708) Garcia BA … Hunt DF (The Journal of biological chemistry 2007) 3 4 56
  5. Identification of histone H3 lysine 36 acetylation as a highly conserved histone modification. (PMID: 17189264) Morris SA … Strahl BD (The Journal of biological chemistry 2007) 3 4 56

Products for H3C15 Gene

Sources for H3C15 Gene