Free for academic non-profit institutions. Other users need a Commercial license

Aliases for H1F0 Gene

Aliases for H1F0 Gene

  • H1 Histone Family Member 0 2 3 5
  • H1.0, H1(0), H1-0 2 3
  • Histone H1(0) 3 4
  • Histone H1.0 3 4
  • Histone H1' 3 4
  • H1FV 3 4
  • H1 Histone Family, Member 0 2
  • H10 3

External Ids for H1F0 Gene

Previous HGNC Symbols for H1F0 Gene

  • H1FV

Previous GeneCards Identifiers for H1F0 Gene

  • GC22P034815
  • GC22P036444
  • GC22P036525
  • GC22P038201
  • GC22P021168

Summaries for H1F0 Gene

Entrez Gene Summary for H1F0 Gene

  • Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-independent histone that is a member of the histone H1 family. [provided by RefSeq, Oct 2015]

GeneCards Summary for H1F0 Gene

H1F0 (H1 Histone Family Member 0) is a Protein Coding gene. Diseases associated with H1F0 include Retinal Cancer and Deafness, Autosomal Dominant 25. Among its related pathways are Apoptosis induced DNA fragmentation and Cell cycle_Chromosome condensation in prometaphase. Gene Ontology (GO) annotations related to this gene include chromatin DNA binding.

UniProtKB/Swiss-Prot for H1F0 Gene

  • Histones H1 are necessary for the condensation of nucleosome chains into higher-order structures. The H1F0 histones are found in cells that are in terminal stages of differentiation or that have low rates of cell division.

Additional gene information for H1F0 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for H1F0 Gene

Genomics for H1F0 Gene

GeneHancer (GH) Regulatory Elements for H1F0 Gene

Promoters and enhancers for H1F0 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH22J037801 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 568.8 +0.4 437 7.3 SUZ12 ZBTB33 DACH1 HDGF MTA3 NR2F6 SP1 ZFX CBFA2T2 HCFC1 GCAT H1F0 GALR3 DDX17 ANKRD54 EIF3L MIR659 CSNK1E PLA2G6 CBY1
GH22J037745 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 18.3 -54.4 -54378 10.9 NR2F6 SP1 ZFX MLLT1 L3MBTL2 YY1 ZBTB7A ZNF384 IKZF1 POLR2A TRIOBP H1F0 GCAT GGA1 LGALS2 PICK1 LGALS1 ANKRD54 POLR2F CDC42EP1
GH22J037672 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.6 -129.5 -129534 6.7 LCORL DACH1 SPI1 HDGF BCL6B SP1 ZFX CBFA2T2 MLLT1 ZNF687 GC22M043145 GC22P037676 GC22P037677 LGALS1 NOL12 GGA1 SH3BP1 LOC101927051 DDX17 H1F0
GH22J038174 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.5 +373.7 373716 8.7 LCORL HDGF BCL6B FOXA1 NR2F6 SP1 MNT SMARCE1 ZKSCAN8 CBFA2T2 PLA2G6 MAFF ENSG00000228274 CSNK1E DDX17 ANKRD54 CBY1 ENSG00000230912 GGA1 TMEM184B
GH22J037606 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.6 -195.7 -195735 5 ZBTB33 DACH1 SPI1 FOXA1 SP1 SMARCE1 ZFX HCFC1 MLLT1 ZNF687 GGA1 DDX17 SH3BP1 EIF3L H1F0 TRIOBP GC22P037617 PIR36618
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around H1F0 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the H1F0 gene promoter:
  • CREB
  • deltaCREB
  • GATA-2
  • Lmo2
  • Pax-4a
  • Pax-5
  • Pax-6
  • PPAR-gamma1
  • PPAR-gamma2
  • STAT3

Genomic Locations for H1F0 Gene

Genomic Locations for H1F0 Gene
2,344 bases
Plus strand
2,330 bases
Plus strand

Genomic View for H1F0 Gene

Genes around H1F0 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H1F0 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H1F0 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for H1F0 Gene

Proteins for H1F0 Gene

  • Protein details for H1F0 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Histone H1.0
    Protein Accession:
    Secondary Accessions:
    • B2R6I0
    • B4DRD6
    • Q6FG88
    • Q8N6R3

    Protein attributes for H1F0 Gene

    194 amino acids
    Molecular mass:
    20863 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for H1F0 Gene


neXtProt entry for H1F0 Gene

Post-translational modifications for H1F0 Gene

Other Protein References for H1F0 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for H1F0 Gene

Domains & Families for H1F0 Gene

Gene Families for H1F0 Gene

Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for H1F0 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the histone H1/H5 family.
  • Belongs to the histone H1/H5 family.
genes like me logo Genes that share domains with H1F0: view

Function for H1F0 Gene

Molecular function for H1F0 Gene

UniProtKB/Swiss-Prot Function:
Histones H1 are necessary for the condensation of nucleosome chains into higher-order structures. The H1F0 histones are found in cells that are in terminal stages of differentiation or that have low rates of cell division.
UniProtKB/Swiss-Prot Induction:
Both the unedited and the RNA edited versions are induced by butyrate (at protein level). Only RNA edited version is induced by DTT, vinblastine or TNF (at protein level).
GENATLAS Biochemistry:
linker histone 1 family 0,replacement subtype,replication-independent,involved in basal repression of gene expression

Phenotypes From GWAS Catalog for H1F0 Gene

Gene Ontology (GO) - Molecular Function for H1F0 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IEA --
GO:0003680 AT DNA binding IEA --
GO:0003690 double-stranded DNA binding IEA,IBA 21873635
GO:0003723 RNA binding HDA 22658674
GO:0005515 protein binding IBA,IPI 9499053
genes like me logo Genes that share ontologies with H1F0: view
genes like me logo Genes that share phenotypes with H1F0: view

Animal Models for H1F0 Gene

MGI Knock Outs for H1F0:

Animal Model Products

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for H1F0 - Now 50% OFF >
  • * H1F0 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * H1F0 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for H1F0 Gene

Localization for H1F0 Gene

Subcellular locations from UniProtKB/Swiss-Prot for H1F0 Gene

Nucleus. Chromosome. Note=The RNA edited version has been localized to nuclear speckles. During mitosis, it appears in the vicinity of condensed chromosomes.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for H1F0 gene
Compartment Confidence
cytoskeleton 5
nucleus 5
golgi apparatus 5
cytosol 2
plasma membrane 1
extracellular 1
mitochondrion 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear bodies (3)
  • Nucleus (3)
  • Actin filaments (1)
  • Golgi apparatus (1)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for H1F0 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000786 nucleosome IEA --
GO:0000790 nuclear chromatin IBA,IDA 19882353
GO:0005634 nucleus IBA,IDA 21383955
GO:0005654 nucleoplasm TAS --
GO:0005694 chromosome IEA --
genes like me logo Genes that share ontologies with H1F0: view

Pathways & Interactions for H1F0 Gene

genes like me logo Genes that share pathways with H1F0: view

Pathways by source for H1F0 Gene

Gene Ontology (GO) - Biological Process for H1F0 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IGI 19158276
GO:0006309 apoptotic DNA fragmentation TAS --
GO:0006334 nucleosome assembly IEA --
GO:0006342 chromatin silencing IGI 19158276
GO:0006355 regulation of transcription, DNA-templated IBA 21873635
genes like me logo Genes that share ontologies with H1F0: view

No data available for SIGNOR curated interactions for H1F0 Gene

Drugs & Compounds for H1F0 Gene

(1) Drugs for H1F0 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with H1F0: view

Transcripts for H1F0 Gene

mRNA/cDNA for H1F0 Gene

(1) REFSEQ mRNAs :
(10) Additional mRNA sequences :
(365) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Unigene Clusters for H1F0 Gene

H1 histone family, member 0:
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for H1F0 - Now 50% OFF >
  • * H1F0 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * H1F0 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for H1F0 Gene

ExUns: 1 ^ 2a · 2b · 2c · 2d · 2e · 2f · 2g · 2h
SP1: - -
SP2: - -
SP3: -

Relevant External Links for H1F0 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for H1F0 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for H1F0 Gene

Protein differential expression in normal tissues from HIPED for H1F0 Gene

This gene is overexpressed in Uterus (8.0) and Fetal gut (7.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for H1F0 Gene

Protein tissue co-expression partners for H1F0 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of H1F0 Gene:


SOURCE GeneReport for Unigene cluster for H1F0 Gene:


Evidence on tissue expression from TISSUES for H1F0 Gene

  • Nervous system(5)
  • Intestine(4.6)
  • Liver(3.9)
  • Muscle(2.8)
  • Kidney(2.7)
  • Blood(2.5)
  • Lung(2.5)
  • Skin(2.4)
  • Bone marrow(2.3)
  • Heart(2.3)
  • Spleen(2.2)
  • Thyroid gland(2.2)
genes like me logo Genes that share expression patterns with H1F0: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for H1F0 Gene

Orthologs for H1F0 Gene

This gene was present in the common ancestor of chordates.

Orthologs for H1F0 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia H1F0 35
  • 100 (a)
LOC743278 34
  • 98.46 (n)
(Bos Taurus)
Mammalia H1F0 35
  • 95 (a)
(Mus musculus)
Mammalia H1f0 17 35 34
  • 91.73 (n)
(Gallus gallus)
Aves H1F0 35 35
  • 67 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.4764 34
African clawed frog
(Xenopus laevis)
Amphibia LOC398662 34
(Danio rerio)
Actinopterygii h1f0 35
  • 58 (a)
wufb23b02 34
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.10060 34
Species where no ortholog for H1F0 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for H1F0 Gene

Gene Tree for H1F0 (if available)
Gene Tree for H1F0 (if available)
Evolutionary constrained regions (ECRs) for H1F0: view image

Paralogs for H1F0 Gene

(6) SIMAP similar genes for H1F0 Gene using alignment to 1 proteins:

  • H10_HUMAN
genes like me logo Genes that share paralogs with H1F0: view

No data available for Paralogs for H1F0 Gene

Variants for H1F0 Gene

Sequence variations from dbSNP and Humsavar for H1F0 Gene

SNP ID Clin Chr 22 pos Variation AA Info Type
rs1000345223 -- 37,807,542(+) A/G downstream_transcript_variant
rs1001381384 -- 37,805,277(+) GAGGCAGAGGCAGAGCCCGAG/GAG 5_prime_UTR_variant
rs1001838698 -- 37,807,020(+) C/T 3_prime_UTR_variant
rs1002567107 -- 37,804,272(+) C/T upstream_transcript_variant
rs1002781131 -- 37,807,028(+) G/A/T 3_prime_UTR_variant

Structural Variations from Database of Genomic Variants (DGV) for H1F0 Gene

Variant ID Type Subtype PubMed ID
esv2758838 CNV loss 17122850

Variation tolerance for H1F0 Gene

Residual Variation Intolerance Score: 34.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.30; 6.70% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for H1F0 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for H1F0 Gene

Disorders for H1F0 Gene

MalaCards: The human disease database

(2) MalaCards diseases for H1F0 Gene - From: DISEASES

Disorder Aliases PubMed IDs
retinal cancer
  • malignant neoplasm of retina
deafness, autosomal dominant 25
  • dfna25
- elite association - COSMIC cancer census association via MalaCards
Search H1F0 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for H1F0

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with H1F0: view

No data available for UniProtKB/Swiss-Prot and Genatlas for H1F0 Gene

Publications for H1F0 Gene

  1. Differential distribution of lysine and arginine residues in the closely related histones H1 and H5. Analysis of a human H1 gene. (PMID: 3084796) Doenecke D … Tönjes R (Journal of molecular biology 1986) 2 3 4 58
  2. Evaluation of candidate stromal epithelial cross-talk genes identifies association between risk of serous ovarian cancer and TERT, a cancer susceptibility "hot-spot". (PMID: 20628624) Johnatty SE … Australian Cancer Study (Ovarian Cancer) (PLoS genetics 2010) 3 45 58
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  4. A genome annotation-driven approach to cloning the human ORFeome. (PMID: 15461802) Collins JE … Dunham I (Genome biology 2004) 3 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for H1F0 Gene

Sources for H1F0 Gene

Loading form....