This gene is located in an imprinted region of chromosome 11 near the insulin-like growth factor 2 (IGF2) gene. This gene is only expressed from the maternally-inherited chromosome, whereas IGF2 is only expressed from the paternally-inherited chromosome. The product of this gene is a long non-coding RNA which functions as a tumor suppressor. Mutations in this gene have been ass... See more...

Aliases for H19 Gene

Subcategory (RNA class) for H19 Gene

lncRNA

Quality Score for this RNA gene is

16

Aliases for H19 Gene

  • H19 Imprinted Maternally Expressed Transcript 2 3 5
  • H19, Imprinted Maternally Expressed Transcript (Non-Protein Coding) 2 3
  • H19, Imprinted Maternally Expressed Untranslated MRNA 2 3
  • Long Intergenic Non-Protein Coding RNA 8 2 3
  • Adult Skeletal Muscle 2 3
  • H19 2 170
  • Non-Protein Coding RNA 8 2
  • MIR675 Host Gene 2
  • HSALNG0082178 169
  • NONHSAG007409 94
  • MIR675 Host 3
  • NCRNA00008 3
  • LINC00008 3
  • D11S813E 3
  • MIR675HG 3
  • ASM1 3
  • ASM 3
  • BWS 3
  • WT2 3

External Ids for H19 Gene

Previous GeneCards Identifiers for H19 Gene

  • GC11U990149
  • GC11M001980
  • GC11M001972
  • GC11M001976
  • GC11M002016
  • GC11M001807

Summaries for H19 Gene

Entrez Gene Summary for H19 Gene

  • This gene is located in an imprinted region of chromosome 11 near the insulin-like growth factor 2 (IGF2) gene. This gene is only expressed from the maternally-inherited chromosome, whereas IGF2 is only expressed from the paternally-inherited chromosome. The product of this gene is a long non-coding RNA which functions as a tumor suppressor. Mutations in this gene have been associated with Beckwith-Wiedemann Syndrome and Wilms tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

GeneCards Summary for H19 Gene

H19 (H19 Imprinted Maternally Expressed Transcript) is an RNA Gene, and is affiliated with the lncRNA class. Diseases associated with H19 include Wilms Tumor 2 and Beckwith-Wiedemann Syndrome.

Gene Wiki entry for H19 Gene

Rfam classification for H19 Gene

Additional gene information for H19 Gene

No data available for CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , PharmGKB "VIP" Summary and piRNA Summary for H19 Gene

Genomics for H19 Gene

GeneHancer (GH) Regulatory Elements for H19 Gene

Promoters and enhancers for H19 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around H19 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the H19 gene promoter:
  • MyoD
  • NF-1
  • NF-1/L
  • p53

Genomic Locations for H19 Gene

Genomic Locations for H19 Gene
chr11:1,995,130-2,001,710
(GRCh38/hg38)
Size:
6,581 bases
Orientation:
Minus strand
chr11:2,016,406-2,022,700
(GRCh37/hg19)
Size:
6,295 bases
Orientation:
Minus strand

Genomic View for H19 Gene

Genes around H19 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H19 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H19 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for H19 Gene

Proteins for H19 Gene

No data available for DME Specific Peptides for H19 Gene

Domains & Families for H19 Gene

genes like me logo Genes that share domains with H19: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for H19 Gene

Function for H19 Gene

Molecular function for H19 Gene

GENATLAS Biochemistry:
DNA segment,single copy,probe H19S1,highly expressed in endodermal and mesodermal embryonic tissues,in adult brain,only in the pons and globus pallidus,paternally imprinted,(?same as ASMG),telomeric imprinting domain at 11p15,containing ASCL2,IGF2 and H19,silenced and hypermethylated in most Wilms tumor and in bladder carcinomas,but hypomethylated in benign ovarian teratoma

Phenotypes From GWAS Catalog for H19 Gene

Phenotypes for H19 Gene

genes like me logo Genes that share phenotypes with H19: view

Human Phenotype Ontology for H19 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for H19 Gene

Localization for H19 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for H19 gene
Compartment Confidence
cytoskeleton 1

Gene Ontology (GO) - Cellular Components for H19 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016442 RISC complex IEA --
genes like me logo Genes that share ontologies with H19: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for H19 Gene

Pathways & Interactions for H19 Gene

PathCards logo

SuperPathways for H19 Gene

No Data Available

Gene Ontology (GO) - Biological Process for H19 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0035195 gene silencing by miRNA IEA --
genes like me logo Genes that share ontologies with H19: view

No data available for Pathways by source and SIGNOR curated interactions for H19 Gene

Drugs & Compounds for H19 Gene

(6) Drugs for H19 Gene - From: PharmGKB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Platinum compounds Pharma 0

(13) Additional Compounds for H19 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with H19: view

Transcripts for H19 Gene

CRISPR Products

Alternative Splicing Database (ASD) splice patterns (SP) for H19 Gene

No ASD Table

Relevant External Links for H19 Gene

GeneLoc Exon Structure for
H19
ECgene alternative splicing isoforms for
H19

Expression for H19 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for H19 Gene

mRNA differential expression in normal tissues according to GTEx for H19 Gene

This gene is overexpressed in Muscle - Skeletal (x11.1) and Adrenal Gland (x4.6).

NURSA nuclear receptor signaling pathways regulating expression of H19 Gene:

H19

SOURCE GeneReport for Unigene cluster for H19 Gene:

Hs.533566

Phenotype-based relationships between genes and organs from Gene ORGANizer for H19 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cheek
  • chin
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • meninges
  • mouth
  • neck
  • outer ear
  • pituitary gland
  • skull
  • tongue
  • tooth
Thorax:
  • chest wall
  • clavicle
  • diaphragm
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • abdominal wall
  • adrenal gland
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • stomach
Pelvis:
  • ovary
  • pelvis
  • penis
  • testicle
  • ureter
  • urethra
  • urinary bladder
  • vagina
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • sweat gland
  • vertebrae
genes like me logo Genes that share expression patterns with H19: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for H19 Gene

Orthologs for H19 Gene

Evolution for H19 Gene

ENSEMBL:
Gene Tree for H19 (if available)
TreeFam:
Gene Tree for H19 (if available)

No data available for Orthologs for H19 Gene

Paralogs for H19 Gene

No data available for Paralogs for H19 Gene

Variants for H19 Gene

Sequence variations from dbSNP and Humsavar for H19 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs431825163 not-provided, Beckwith-Wiedemann syndrome 2,001,815(-) G/A upstream_transcript_variant
rs431825164 not-provided, Beckwith-Wiedemann syndrome 2,001,083(-) G/A genic_upstream_transcript_variant, intron_variant
rs431825165 not-provided, Beckwith-Wiedemann syndrome 2,001,763(-) TTAGCATCTCAAGCTCCTAAATTAGCATCTCAA/TTAGCATCTCAA upstream_transcript_variant
rs431825166 not-provided, Beckwith-Wiedemann syndrome 2,000,708(-) T/A genic_upstream_transcript_variant, intron_variant
rs431825167 not-provided, Beckwith-Wiedemann syndrome 2,000,108(-) C/A/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for H19 Gene

Variant ID Type Subtype PubMed ID
dgv1015n100 CNV gain 25217958
dgv1016n100 CNV gain 25217958
esv29980 CNV loss 17803354
nsv1047474 CNV gain 25217958
nsv467645 CNV gain 19166990
nsv469926 CNV loss 18288195
nsv522320 CNV loss 19592680
nsv553047 CNV gain 21841781
nsv553064 CNV loss 21841781
nsv951283 CNV deletion 24416366

Additional Variant Information for H19 Gene

Human Gene Mutation Database (HGMD)
H19
SNPedia medical, phenotypic, and genealogical associations of SNPs for
H19

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for H19 Gene

Disorders for H19 Gene

MalaCards: The human disease database

(99) MalaCards diseases for H19 Gene - From: LncRNADisease, HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
wilms tumor 2
  • wt2
beckwith-wiedemann syndrome
  • bws
hemihyperplasia, isolated
  • ih
embryonal carcinoma
  • primary extragonadal embryonal carcinoma
choriocarcinoma
  • chorioepithelioma
- elite association - COSMIC cancer census association via MalaCards
Search H19 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for H19

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with H19: view

No data available for UniProtKB/Swiss-Prot and Genatlas for H19 Gene

Publications for H19 Gene

  1. The H19 gene imprinting in normal pregnancy and pre-eclampsia. (PMID: 19342096) Yu L … Li L (Placenta 2009) 3 23 43 56
  2. Polymorphisms in the H19 gene and the risk of bladder cancer. (PMID: 18262338) Verhaegh GW … Kiemeney LA (European urology 2008) 3 23 43 56
  3. Examination of genetic polymorphisms in newborns for signatures of sex-specific prenatal selection. (PMID: 20587610) Ucisik-Akkaya E … Dorak MT (Molecular human reproduction 2010) 3 43 56
  4. Common genetic variants associated with breast cancer and mammographic density measures that predict disease. (PMID: 20145138) Odefrey F … Australian Twins and Sisters Mammographic Density Study (Cancer research 2010) 3 43 56
  5. FGFR2 and other loci identified in genome-wide association studies are associated with breast cancer in African-American and younger women. (PMID: 20554749) Barnholtz-Sloan JS … Millikan RC (Carcinogenesis 2010) 3 43 56

Products for H19 Gene

Sources for H19 Gene