H1-4 Gene (Protein Coding)

H1.4 Linker Histone, Cluster Member

GC06P027643
GIFtS:
34
Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in ... See more...

Aliases for H1-4 Gene

Aliases for H1-4 Gene

  • H1.4 Linker Histone, Cluster Member 2 3
  • Histone Cluster 1 H1 Family Member E 2 3 5
  • H1 Histone Family, Member 4 2 3
  • Histone Cluster 1, H1e 2 3
  • Histone 1, H1e 2 3
  • Histone H1s-4 3 4
  • Histone H1.4 3 4
  • Histone H1b 3 4
  • HIST1H1E 3 5
  • H1F4 3 4
  • DJ221C16.5 3
  • H1s-4 3
  • H1.4 3
  • RMNS 3
  • H1E 3

External Ids for H1-4 Gene

Previous HGNC Symbols for H1-4 Gene

  • H1F4
  • HIST1H1E

Summaries for H1-4 Gene

Entrez Gene Summary for H1-4 Gene

  • Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]

GeneCards Summary for H1-4 Gene

H1-4 (H1.4 Linker Histone, Cluster Member) is a Protein Coding gene. Diseases associated with H1-4 include Rahman Syndrome. Among its related pathways are Cellular Senescence (REACTOME) and Apoptotic cleavage of cellular proteins. An important paralog of this gene is H1-5.

UniProtKB/Swiss-Prot Summary for H1-4 Gene

  • Histone H1 protein binds to linker DNA between nucleosomes forming the macromolecular structure known as the chromatin fiber. Histones H1 are necessary for the condensation of nucleosome chains into higher-order structured fibers. Acts also as a regulator of individual gene transcription through chromatin remodeling, nucleosome spacing and DNA methylation (By similarity).

Gene Wiki entry for H1-4 Gene

Additional gene information for H1-4 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for H1-4 Gene

Genomics for H1-4 Gene

GeneHancer (GH) Regulatory Elements for H1-4 Gene

Promoters and enhancers for H1-4 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around H1-4 on UCSC Golden Path with GeneCards custom track

Genomic Locations for H1-4 Gene

Genomic Locations for H1-4 Gene
chr6:26,156,331-26,157,115
(GRCh38/hg38)
Size:
785 bases
Orientation:
Plus strand
chr6:26,156,559-26,157,343
(GRCh37/hg19)
Size:
785 bases
Orientation:
Plus strand

Genomic View for H1-4 Gene

Genes around H1-4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H1-4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H1-4 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for H1-4 Gene

Proteins for H1-4 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for H1-4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P10412-H14_HUMAN
    Recommended name:
    Histone H1.4
    Protein Accession:
    P10412
    Secondary Accessions:
    • Q4VB25

    Protein attributes for H1-4 Gene

    Size:
    219 amino acids
    Molecular mass:
    21865 Da
    Quaternary structure:
    No Data Available
    Miscellaneous:
    • This variant accounts for 60% of histone H1.

    Three dimensional structures from OCA and Proteopedia for H1-4 Gene

neXtProt entry for H1-4 Gene

Post-translational modifications for H1-4 Gene

  • H1 histones are progressively phosphorylated during the cell cycle, becoming maximally phosphorylated during late G2 phase and M phase, and being dephosphorylated sharply thereafter.
  • Acetylated at Lys-26. Deacetylated at Lys-26 by SIRT1.
  • Citrullination at Arg-54 (H1R54ci) by PADI4 takes place within the DNA-binding site of H1 and results in its displacement from chromatin and global chromatin decondensation, thereby promoting pluripotency and stem cell maintenance.
  • ADP-ribosylated on Ser-150 in response to DNA damage.
  • Ubiquitination at Lys17
  • Modification sites at PhosphoSitePlus

Other Protein References for H1-4 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for H1-4 Gene

Domains & Families for H1-4 Gene

Gene Families for H1-4 Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Predicted intracellular proteins

Protein Domains for H1-4 Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for H1-4 Gene

GenScript: Design optimal peptide antigens:
  • Histone H1e (A3R0T8_HUMAN)
  • Histone H1b (H14_HUMAN)
  • Histone cluster 1, H1e (Q4VB24_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P10412

UniProtKB/Swiss-Prot:

H14_HUMAN :
  • The C-terminal domain is required for high-affinity binding to chromatin.
  • Belongs to the histone H1/H5 family.
Domain:
  • The C-terminal domain is required for high-affinity binding to chromatin.
Family:
  • Belongs to the histone H1/H5 family.
genes like me logo Genes that share domains with H1-4: view

Function for H1-4 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for H1-4 Gene

UniProtKB/Swiss-Prot Function:
Histone H1 protein binds to linker DNA between nucleosomes forming the macromolecular structure known as the chromatin fiber. Histones H1 are necessary for the condensation of nucleosome chains into higher-order structured fibers. Acts also as a regulator of individual gene transcription through chromatin remodeling, nucleosome spacing and DNA methylation (By similarity).

Phenotypes From GWAS Catalog for H1-4 Gene

Gene Ontology (GO) - Molecular Function for H1-4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000166 nucleotide binding IEA --
GO:0003677 DNA binding IEA --
GO:0003690 double-stranded DNA binding IBA 21873635
GO:0003723 RNA binding HDA 22681889
GO:0005509 calcium ion binding IEA --
genes like me logo Genes that share ontologies with H1-4: view
genes like me logo Genes that share phenotypes with H1-4: view

Human Phenotype Ontology for H1-4 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H1-4

No data available for Enzyme Numbers (IUBMB) , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for H1-4 Gene

Localization for H1-4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for H1-4 Gene

Nucleus. Chromosome. Note=Mainly localizes in heterochromatin. Dysplays a punctuate staining pattern in the nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for H1-4 gene
Compartment Confidence
nucleus 5
cytosol 3

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear speckles (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for H1-4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000786 nucleosome IEA --
GO:0000788 nuclear nucleosome IEA --
GO:0000790 nuclear chromatin IBA 21873635
GO:0005634 nucleus IBA,IDA 17540172
GO:0005694 chromosome IEA --
genes like me logo Genes that share ontologies with H1-4: view

Pathways & Interactions for H1-4 Gene

genes like me logo Genes that share pathways with H1-4: view

Pathways by source for H1-4 Gene

2 Qiagen pathways for H1-4 Gene
  • Granzyme-A Pathway
  • PKA Signaling
1 Cell Signaling Technology pathway for H1-4 Gene

Gene Ontology (GO) - Biological Process for H1-4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IEA --
GO:0006334 nucleosome assembly IEA --
GO:0006355 regulation of transcription, DNA-templated IBA 21873635
GO:0006357 regulation of transcription by RNA polymerase II IEA --
GO:0016584 nucleosome positioning IBA 21873635
genes like me logo Genes that share ontologies with H1-4: view

No data available for SIGNOR curated interactions for H1-4 Gene

Drugs & Compounds for H1-4 Gene

Products:

  1. Drug

(2) Drugs for H1-4 Gene - From: DrugBank and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Copper Approved, Investigational Pharma Target 227
genes like me logo Genes that share compounds with H1-4: view

Transcripts for H1-4 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for H1-4 Gene

(1) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(4) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for H1-4

Alternative Splicing Database (ASD) splice patterns (SP) for H1-4 Gene

No ASD Table

Relevant External Links for H1-4 Gene

GeneLoc Exon Structure for
H1-4
ECgene alternative splicing isoforms for
H1-4

Expression for H1-4 Gene

Products:

  1. Primer

NURSA nuclear receptor signaling pathways regulating expression of H1-4 Gene:

H1-4

SOURCE GeneReport for Unigene cluster for H1-4 Gene:

Hs.248133

Evidence on tissue expression from TISSUES for H1-4 Gene

  • Liver(4.7)
  • Spleen(4.3)
  • Stomach(3.7)
  • Intestine(3.5)
  • Muscle(3.5)
  • Nervous system(3.3)
  • Kidney(3.1)
  • Heart(3)
No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for H1-4 Gene

Orthologs for H1-4 Gene

This gene was present in the common ancestor of chordates.

Orthologs for H1-4 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia HIST1H1E 33
  • 100 (a)
 OneToOne
LOC471881 32
  • 99.39 (n)
dog
(Canis familiaris)
 Mammalia HIST1H1E 33
  • 97 (a)
 OneToOne
mouse
(Mus musculus)
 Mammalia Hist1h1e 33
  • 94 (a)
 OneToOne
cow
(Bos Taurus)
 Mammalia HIST1H1E 33 32
  • 89.19 (n)
 OneToOne
oppossum
(Monodelphis domestica)
 Mammalia -- 33
  • 86 (a)
 ManyToMany
-- 33
  • 78 (a)
 ManyToMany
platypus
(Ornithorhynchus anatinus)
 Mammalia -- 33
  • 35 (a)
 OneToMany
chicken
(Gallus gallus)
 Aves HIST1H111L 33
  • 75 (a)
 ManyToMany
HIST1H111R 33
  • 75 (a)
 ManyToMany
-- 33
  • 67 (a)
 ManyToMany
African clawed frog
(Xenopus laevis)
 Amphibia Xl.806 32
tropical clawed frog
(Silurana tropicalis)
 Amphibia Str.494 32
zebrafish
(Danio rerio)
 Actinopterygii CU457819.3 33
  • 74 (a)
 ManyToMany
CABZ01086354.1 33
  • 72 (a)
 ManyToMany
si:ch211-113a14.12 33
  • 71 (a)
 ManyToMany
FP325123.1 33
  • 71 (a)
 ManyToMany
zgc:153405 33
  • 71 (a)
 ManyToMany
si:dkey-261m9.12 33
  • 70 (a)
 ManyToMany
si:ch211-113a14.24 33
  • 70 (a)
 ManyToMany
si:ch211-113a14.18 33
  • 70 (a)
 ManyToMany
si:dkey-108k21.14 33
  • 69 (a)
 ManyToMany
si:dkey-108k21.10 33
  • 69 (a)
 ManyToMany
zgc:163061 33 33
  • 69 (a)
 ManyToMany
zgc:110425 33
  • 69 (a)
 ManyToMany
histh1l 33
  • 68 (a)
 ManyToMany
si:dkey-108k21.21 33
  • 64 (a)
 ManyToMany
-- 32
Species where no ortholog for H1-4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for H1-4 Gene

ENSEMBL:
Gene Tree for H1-4 (if available)
TreeFam:
Gene Tree for H1-4 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for H1-4: view image

Paralogs for H1-4 Gene

Paralogs for H1-4 Gene

genes like me logo Genes that share paralogs with H1-4: view

Variants for H1-4 Gene

Sequence variations from dbSNP and Humsavar for H1-4 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1131690805 pathogenic, likely-pathogenic, RAHMAN SYNDROME, not provided, Inborn genetic diseases 26,156,816(+) GGGGG/GGGGGG coding_sequence_variant, frameshift
rs1131690806 pathogenic, RAHMAN SYNDROME, not provided 26,156,827(+) CCCCC/CCCCCC coding_sequence_variant, frameshift
rs1131690807 pathogenic, RAHMAN SYNDROME 26,156,826(+) ACCCCCAAGAAGAGCGCCAAGAA/ coding_sequence_variant, frameshift
rs768731472 A colorectal cancer sample 26,156,773(+) C/T coding_sequence_variant, missense_variant
rs1554162872 pathogenic, not provided 26,156,822(+) GG/GGG coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for H1-4 Gene

Variant ID Type Subtype PubMed ID
dgv375n21 CNV loss 19592680
dgv5926n100 CNV gain 25217958
esv3608394 CNV loss 21293372
esv3608395 CNV gain 21293372
nsv1023453 CNV gain 25217958
nsv428137 CNV loss 18775914

Variation tolerance for H1-4 Gene

Residual Variation Intolerance Score: 18% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.29; 40.94% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for H1-4 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
H1-4

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for H1-4 Gene

Disorders for H1-4 Gene

MalaCards: The human disease database

(1) MalaCards diseases for H1-4 Gene - From: OMIM, ClinVar, and GeneCards

Disorder Aliases PubMed IDs
rahman syndrome
  • rmns
- elite association - COSMIC cancer census association via MalaCards
Search H1-4 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

H14_HUMAN
  • Rahman syndrome (RMNS) [MIM:617537]: An autosomal dominant syndrome characterized by intellectual disability and overgrowth manifesting as increased birth length, height, weight, and/or head circumference. {ECO:0000269 PubMed:28475857}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for H1-4

ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with H1-4: view

No data available for Genatlas for H1-4 Gene

Publications for H1-4 Gene

  1. The human and mouse replication-dependent histone genes. (PMID: 12408966) Marzluff WF … Maltais LJ (Genomics 2002) 2 3 4 56
  2. Isolation and characterization of two human H1 histone genes within clusters of core histone genes. (PMID: 1916825) Albig W … Doenecke D (Genomics 1991) 2 3 4 56
  3. Mutations in Epigenetic Regulation Genes Are a Major Cause of Overgrowth with Intellectual Disability. (PMID: 28475857) Tatton-Brown K … Rahman N (American journal of human genetics 2017) 3 4 56
  4. L3MBTL1, a histone-methylation-dependent chromatin lock. (PMID: 17540172) Trojer P … Reinberg D (Cell 2007) 3 23 56
  5. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. (PMID: 17081983) Olsen JV … Mann M (Cell 2006) 3 4 56

ExternalLinks

View latest publications for H1-4 gene in Mastermind

Products for H1-4 Gene

Sources for H1-4 Gene