Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycop... See more...

Aliases for GYPC Gene

Aliases for GYPC Gene

  • Glycophorin C (Gerbich Blood Group) 2 3 5
  • Sialoglycoprotein D 3 4
  • Glycoprotein Beta 3 4
  • Glycoconnectin 3 4
  • Glycophorin-C 3 4
  • Glycophorin-D 3 4
  • PAS-2' 3 4
  • GPC 3 4
  • GPD 3 4
  • CD236 Antigen 4
  • CD236R 3
  • CD236 3
  • PAS-2 3
  • GYPD 3
  • GLPC 4
  • GE 3

External Ids for GYPC Gene

Previous GeneCards Identifiers for GYPC Gene

  • GC02P124707
  • GC02P125340
  • GC02P127318
  • GC02P127506
  • GC02P127129
  • GC02P127413
  • GC02P119723

Summaries for GYPC Gene

Entrez Gene Summary for GYPC Gene

  • Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycophorin D, result from single point mutations of the glycophorin C gene. The glycophorin C protein has very little homology with glycophorins A and B. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]

GeneCards Summary for GYPC Gene

GYPC (Glycophorin C (Gerbich Blood Group)) is a Protein Coding gene. Diseases associated with GYPC include Blood Group, Gerbich System and Malaria. Among its related pathways are Cell surface interactions at the vascular wall and Response to elevated platelet cytosolic Ca2+.

UniProtKB/Swiss-Prot Summary for GYPC Gene

  • This protein is a minor sialoglycoprotein in human erythrocyte membranes. The blood group Gerbich antigens and receptors for Plasmodium falciparum merozoites are most likely located within the extracellular domain. Glycophorin-C plays an important role in regulating the stability of red cells.

Additional gene information for GYPC Gene

No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for GYPC Gene

Genomics for GYPC Gene

GeneHancer (GH) Regulatory Elements for GYPC Gene

Promoters and enhancers for GYPC Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GYPC on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the GYPC gene promoter:
  • AREB6
  • GATA-1
  • MAZR
  • NF-kappaB
  • NF-kappaB1

Genomic Locations for GYPC Gene

Genomic Locations for GYPC Gene
40,741 bases
Plus strand
40,738 bases
Plus strand

Genomic View for GYPC Gene

Genes around GYPC on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GYPC Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GYPC Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GYPC Gene

Proteins for GYPC Gene

  • Protein details for GYPC Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Accession:
    Secondary Accessions:
    • B2R522
    • Q53SV9
    • Q92642

    Protein attributes for GYPC Gene

    128 amino acids
    Molecular mass:
    13811 Da
    Quaternary structure:
    No Data Available
    • Sequence=CAA32093.1; Type=Frameshift; Positions=35; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for GYPC Gene

    Alternative splice isoforms for GYPC Gene


neXtProt entry for GYPC Gene

Post-translational modifications for GYPC Gene

  • O-glycosylated with core 1 or possibly core 8 glycans.
  • Glycosylation at Ser3, Ser24, Thr4, Ser26, Ser6, Thr27, Thr28, Asn8, Ser9, Thr10, Thr31, Thr32, Thr33, Ser15, and Ser42
  • Modification sites at PhosphoSitePlus
  • Glycosylation from GlyConnect
    • GLPC_HUMAN (189)

Other Protein References for GYPC Gene

Antibody Products

  • Boster Bio Antibodies for GYPC

No data available for DME Specific Peptides for GYPC Gene

Domains & Families for GYPC Gene

Gene Families for GYPC Gene

Human Protein Atlas (HPA):
  • Blood group antigen proteins
  • CD markers
  • Predicted membrane proteins

Protein Domains for GYPC Gene

Suggested Antigen Peptide Sequences for GYPC Gene

GenScript: Design optimal peptide antigens:
  • Glycophorin C (A8D444_HUMAN)
  • Mutant glycophorin C (A8UKE9_HUMAN)
  • Mutant glycophorin C (A8UKF0_HUMAN)
  • Glycophorin C (A8UKF1_HUMAN)
  • Sialoglycoprotein D (GLPC_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the glycophorin-C family.
  • Belongs to the glycophorin-C family.
genes like me logo Genes that share domains with GYPC: view

Function for GYPC Gene

Molecular function for GYPC Gene

UniProtKB/Swiss-Prot Function:
This protein is a minor sialoglycoprotein in human erythrocyte membranes. The blood group Gerbich antigens and receptors for Plasmodium falciparum merozoites are most likely located within the extracellular domain. Glycophorin-C plays an important role in regulating the stability of red cells.
GENATLAS Biochemistry:
glycophorin C and D (Gerbich blood group),plasmodium falciparum receptor

Phenotypes From GWAS Catalog for GYPC Gene

Gene Ontology (GO) - Molecular Function for GYPC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16669616
genes like me logo Genes that share ontologies with GYPC: view
genes like me logo Genes that share phenotypes with GYPC: view

Human Phenotype Ontology for GYPC Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for GYPC

Clone Products

  • Addgene plasmids for GYPC

No data available for Enzyme Numbers (IUBMB) , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for GYPC Gene

Localization for GYPC Gene

Subcellular locations from UniProtKB/Swiss-Prot for GYPC Gene

Cell membrane; Single-pass type III membrane protein. Note=Linked to the membrane via band 4.1.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GYPC gene
Compartment Confidence
plasma membrane 5
cytoskeleton 5
cytosol 3
extracellular 2
endoplasmic reticulum 2
nucleus 1
endosome 1
golgi apparatus 1
mitochondrion 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for GYPC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane NAS,TAS --
GO:0005887 integral component of plasma membrane TAS 2416746
GO:0016020 membrane IBA 21873635
GO:0016021 integral component of membrane IEA --
GO:0030863 cortical cytoskeleton IBA,IDA 16669616
genes like me logo Genes that share ontologies with GYPC: view

Pathways & Interactions for GYPC Gene

genes like me logo Genes that share pathways with GYPC: view

Pathways by source for GYPC Gene

1 KEGG pathway for GYPC Gene

Gene Ontology (GO) - Biological Process for GYPC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0050900 leukocyte migration TAS --
genes like me logo Genes that share ontologies with GYPC: view

No data available for SIGNOR curated interactions for GYPC Gene

Drugs & Compounds for GYPC Gene

(8) Drugs for GYPC Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(7) Additional Compounds for GYPC Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with GYPC: view

Transcripts for GYPC Gene

mRNA/cDNA for GYPC Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for GYPC

Clone Products

  • Addgene plasmids for GYPC

Alternative Splicing Database (ASD) splice patterns (SP) for GYPC Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b · 6c
SP1: -
SP2: - -
SP3: - - -

Relevant External Links for GYPC Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for GYPC Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GYPC Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for GYPC Gene

This gene is overexpressed in Whole Blood (x19.9).

Protein differential expression in normal tissues from HIPED for GYPC Gene

This gene is overexpressed in Prostate (9.2), Spleen (8.0), Urinary Bladder (7.3), and Neutrophil (6.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for GYPC Gene

Protein tissue co-expression partners for GYPC Gene

NURSA nuclear receptor signaling pathways regulating expression of GYPC Gene:


SOURCE GeneReport for Unigene cluster for GYPC Gene:


mRNA Expression by UniProt/SwissProt for GYPC Gene:

Tissue specificity: Glycophorin-C is expressed in erythrocytes. Glycophorin-D and IsoGPC are ubiquitously expressed.

Evidence on tissue expression from TISSUES for GYPC Gene

  • Blood(4.6)
  • Spleen(4.6)
  • Liver(4.4)
  • Bone marrow(2.9)
  • Skin(2.8)
  • Lymph node(2.6)
  • Heart(2.4)
  • Kidney(2.4)
  • Lung(2.4)
  • Muscle(2.3)
  • Nervous system(2.3)

Phenotype-based relationships between genes and organs from Gene ORGANizer for GYPC Gene

Germ Layers:
  • mesoderm
  • cardiovascular
  • immune
  • blood
  • red blood cell
genes like me logo Genes that share expression patterns with GYPC: view

Orthologs for GYPC Gene

This gene was present in the common ancestor of chordates.

Orthologs for GYPC Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia GYPC 33
  • 91 (a)
(Mus musculus)
Mammalia Gypc 17 33 32
  • 79.93 (n)
(Rattus norvegicus)
Mammalia Gypc 32
  • 79.21 (n)
(Canis familiaris)
Mammalia GYPC 33
  • 74 (a)
(Bos Taurus)
Mammalia GPC 33
  • 67 (a)
(Ornithorhynchus anatinus)
Mammalia GYPC 33
  • 53 (a)
(Monodelphis domestica)
Mammalia GYPC 33
  • 34 (a)
(Gallus gallus)
Aves GYPC 33 32
  • 67.44 (n)
(Anolis carolinensis)
Reptilia GYPC 33
  • 86 (a)
(Danio rerio)
Actinopterygii gypc 33
  • 58 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.2910 32
Species where no ortholog for GYPC was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for GYPC Gene

Gene Tree for GYPC (if available)
Gene Tree for GYPC (if available)
Evolutionary constrained regions (ECRs) for GYPC: view image

Paralogs for GYPC Gene

(5) SIMAP similar genes for GYPC Gene using alignment to 5 proteins:

  • A8D444_HUMAN
genes like me logo Genes that share paralogs with GYPC: view

No data available for Paralogs for GYPC Gene

Variants for GYPC Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for GYPC Gene

GYPC is responsible for the Gerbich blood group system (Ge) [MIM:616089]. Ge negative individuals carry a deletion of GYPC exon 3.
Deletion of exon 3 in GYPC results in resistance to Plasmodium falciparum invasion and protection against severe malaria [MIM:611162].

Sequence variations from dbSNP and Humsavar for GYPC Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs121912760 affects, Blood group, Gerbich system, - 126,656,286(+) A/G 5_prime_UTR_variant, coding_sequence_variant, genic_upstream_transcript_variant, missense_variant
rs121912761 affects, Blood group, Gerbich system, - 126,656,303(+) C/A/T 5_prime_UTR_variant, coding_sequence_variant, genic_upstream_transcript_variant, missense_variant
rs1553469573 affects, Blood group, Gerbich system 126,690,252(+) CAGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAG/CAG 5_prime_UTR_variant, coding_sequence_variant, initiator_codon_variant, intron_variant, splice_acceptor_variant
rs1553470034 pathogenic, protective, Glycophorin c, gerbich variant, Malaria, resistance to 126,693,861(+) CAGAGCCTGATCCAGGGATGTCTGGATGGCCGGATGGCAGAATGGAGACCTCCACCCCCACCATAATGGACATTGTCGTCATTGCAG/CAG coding_sequence_variant, intron_variant, splice_acceptor_variant
rs1000002500 -- 126,669,780(+) C/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for GYPC Gene

Variant ID Type Subtype PubMed ID
esv2429496 CNV deletion 19546169
esv2672764 CNV deletion 23128226
esv2720722 CNV deletion 23290073
esv3414587 CNV insertion 20981092
esv3592344 CNV loss 21293372
nsv1142296 CNV deletion 24896259
nsv583011 CNV loss 21841781
nsv583012 CNV loss 21841781
nsv583013 CNV gain 21841781
nsv583014 CNV loss 21841781
nsv583015 CNV loss 21841781

Variation tolerance for GYPC Gene

Residual Variation Intolerance Score: 85.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.03; 37.30% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for GYPC Gene

Blood Group Antigen Gene Mutation Database (BGMUT)
Blood Group System
Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

Disorders for GYPC Gene

MalaCards: The human disease database

(12) MalaCards diseases for GYPC Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
blood group, gerbich system
  • ge
  • malaria, susceptibility to
hereditary elliptocytosis
  • congenital elliptocytosis
  • varicella
necrotizing gastritis
- elite association - COSMIC cancer census association via MalaCards
Search GYPC in MalaCards View complete list of genes associated with diseases

Additional Disease Information for GYPC

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with GYPC: view

No data available for UniProtKB/Swiss-Prot and Genatlas for GYPC Gene

Publications for GYPC Gene

  1. Plasmodium falciparum erythrocyte invasion through glycophorin C and selection for Gerbich negativity in human populations. (PMID: 12469115) Maier AG … Cowman AF (Nature medicine 2003) 3 4 23 56
  2. A point mutation in the GYPC gene results in the expression of the blood group Ana antigen on glycophorin D but not on glycophorin C: further evidence that glycophorin D is a product of the GYPC gene. (PMID: 8219208) Daniels G … Cedergren B (Blood 1993) 3 4 23 56
  3. Point mutation in the glycophorin C gene results in the expression of the blood group antigen Dha. (PMID: 1413665) King MJ … Reid ME (Vox sanguinis 1992) 3 4 23 56
  4. Molecular characterization of erythrocyte glycophorin C variants. (PMID: 1991173) Chang S … Mohandas N (Blood 1991) 3 4 23 56
  5. An ubiquitous isoform of glycophorin C is produced by alternative splicing. (PMID: 2349119) Le Van Kim C … Colin Y (Nucleic acids research 1990) 3 4 23 56

Products for GYPC Gene

Sources for GYPC Gene