This gene encodes a proline-rich protein with coiled coil domains that may be a subunit of a BRAF35-HDAC (BHC) histone deacetylase complex. This gene may function as an oncogene in breast cancer and enhanced expression of the encoded protein has been observed in breast cancer patients. [provided by RefSeq, May 2017] See more...

Aliases for GSE1 Gene

Aliases for GSE1 Gene

  • Gse1 Coiled-Coil Protein 2 3 5
  • Genetic Suppressor Element 1 2 3 4
  • KIAA0182 2 3 4
  • Gse1 Coiled-Coil Protein Homolog (Mouse) 2
  • Gse1 Coiled-Coil Protein Homolog 3
  • CTC-786C10.1 3
  • CRHSP24 3

External Ids for GSE1 Gene

Previous HGNC Symbols for GSE1 Gene

  • KIAA0182

Previous GeneCards Identifiers for GSE1 Gene

  • GC16P085646

Summaries for GSE1 Gene

Entrez Gene Summary for GSE1 Gene

  • This gene encodes a proline-rich protein with coiled coil domains that may be a subunit of a BRAF35-HDAC (BHC) histone deacetylase complex. This gene may function as an oncogene in breast cancer and enhanced expression of the encoded protein has been observed in breast cancer patients. [provided by RefSeq, May 2017]

GeneCards Summary for GSE1 Gene

GSE1 (Gse1 Coiled-Coil Protein) is a Protein Coding gene. Diseases associated with GSE1 include Central Nervous System Primitive Neuroectodermal Neoplasm.

Gene Wiki entry for GSE1 Gene

Additional gene information for GSE1 Gene

No data available for CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for GSE1 Gene

Genomics for GSE1 Gene

GeneHancer (GH) Regulatory Elements for GSE1 Gene

Promoters and enhancers for GSE1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GSE1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for GSE1 Gene

Genomic Locations for GSE1 Gene
chr16:85,169,525-85,676,206
(GRCh38/hg38)
Size:
506,682 bases
Orientation:
Plus strand
chr16:85,645,015-85,709,812
(GRCh37/hg19)
Size:
64,798 bases
Orientation:
Plus strand

Genomic View for GSE1 Gene

Genes around GSE1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GSE1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GSE1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GSE1 Gene

Proteins for GSE1 Gene

  • Protein details for GSE1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q14687-GSE1_HUMAN
    Recommended name:
    Genetic suppressor element 1
    Protein Accession:
    Q14687
    Secondary Accessions:
    • D3DUM4
    • Q8IY61
    • Q96GA4
    • Q9BW09

    Protein attributes for GSE1 Gene

    Size:
    1217 amino acids
    Molecular mass:
    136164 Da
    Quaternary structure:
    • May be a component of a BHC histone deacetylase complex that contains HDAC1, HDAC2, HMG20B/BRAF35, KDM1A, RCOR1/CoREST, PHF21A/BHC80, ZMYM2, ZNF217, ZMYM3, GSE1 and GTF2I.
    SequenceCaution:
    • Sequence=BAA11499.2; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for GSE1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for GSE1 Gene

Post-translational modifications for GSE1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for GSE1 Gene

Domains & Families for GSE1 Gene

Gene Families for GSE1 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for GSE1 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for GSE1 Gene

GenScript: Design optimal peptide antigens:
  • Genetic suppressor element 1 (GSE1_HUMAN)
genes like me logo Genes that share domains with GSE1: view

No data available for Graphical View of Domain Structure and UniProtKB/Swiss-Prot for GSE1 Gene

Function for GSE1 Gene

Molecular function for GSE1 Gene

UniProtKB/Swiss-Prot Induction:
Negatively regulated by miR-489-5p.

Phenotypes From GWAS Catalog for GSE1 Gene

Gene Ontology (GO) - Molecular Function for GSE1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16189514
genes like me logo Genes that share ontologies with GSE1: view
genes like me logo Genes that share phenotypes with GSE1: view

Animal Models for GSE1 Gene

MGI Knock Outs for GSE1:
  • Gse1 Gse1<tm1a(EUCOMM)Wtsi>

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for GSE1

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for GSE1 Gene

Localization for GSE1 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GSE1 gene
Compartment Confidence
nucleus 3
mitochondrion 2
extracellular 1
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Mitochondria (2)
  • Nucleoplasm (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for GSE1 Gene

Pathways & Interactions for GSE1 Gene

PathCards logo

SuperPathways for GSE1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for GSE1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for GSE1 Gene

Drugs & Compounds for GSE1 Gene

No Compound Related Data Available

Transcripts for GSE1 Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for GSE1

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for GSE1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8a · 8b · 8c ^ 9a · 9b ^ 10 ^ 11a · 11b ^ 12 ^ 13 ^ 14 ^ 15
SP1:
SP2: - - - - -
SP3:
SP4: -
SP5:
SP6:
SP7:

Relevant External Links for GSE1 Gene

GeneLoc Exon Structure for
GSE1
ECgene alternative splicing isoforms for
GSE1

Expression for GSE1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GSE1 Gene

Protein differential expression in normal tissues from HIPED for GSE1 Gene

This gene is overexpressed in Cervix (31.9), Placenta (18.2), and Monocytes (8.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for GSE1 Gene



Protein tissue co-expression partners for GSE1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of GSE1 Gene:

GSE1

SOURCE GeneReport for Unigene cluster for GSE1 Gene:

Hs.461647

Evidence on tissue expression from TISSUES for GSE1 Gene

  • Nervous system(3.2)
  • Intestine(2.3)
  • Lung(2.1)
genes like me logo Genes that share expression patterns with GSE1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for GSE1 Gene

Orthologs for GSE1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for GSE1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia GSE1 33 32
  • 97.58 (n)
OneToOne
dog
(Canis familiaris)
Mammalia GSE1 33
  • 91 (a)
OneToOne
KIAA0182 32
  • 88.76 (n)
cow
(Bos Taurus)
Mammalia GSE1 33
  • 89 (a)
OneToOne
KIAA0182 32
  • 86.08 (n)
rat
(Rattus norvegicus)
Mammalia Gse1 32
  • 84.47 (n)
mouse
(Mus musculus)
Mammalia Gse1 17 33 32
  • 84.19 (n)
oppossum
(Monodelphis domestica)
Mammalia GSE1 33
  • 82 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia GSE1 33
  • 81 (a)
OneToOne
chicken
(Gallus gallus)
Aves GSE1 33
  • 76 (a)
OneToOne
KIAA0182 32
  • 74.77 (n)
lizard
(Anolis carolinensis)
Reptilia GSE1 33
  • 75 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia gse1 32
  • 61.97 (n)
Str.17615 32
African clawed frog
(Xenopus laevis)
Amphibia Xl.1433 32
zebrafish
(Danio rerio)
Actinopterygii gse1 33 32
  • 60.63 (n)
OneToOne
Species where no ortholog for GSE1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for GSE1 Gene

ENSEMBL:
Gene Tree for GSE1 (if available)
TreeFam:
Gene Tree for GSE1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for GSE1: view image

Paralogs for GSE1 Gene

(5) SIMAP similar genes for GSE1 Gene using alignment to 4 proteins:

  • GSE1_HUMAN
  • C9JLW9_HUMAN
  • H0Y613_HUMAN
  • H7C3B5_HUMAN
genes like me logo Genes that share paralogs with GSE1: view

No data available for Paralogs for GSE1 Gene

Variants for GSE1 Gene

Sequence variations from dbSNP and Humsavar for GSE1 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs757859891 A colorectal cancer sample 85,661,384(+) C/A/T coding_sequence_variant, genic_downstream_transcript_variant, missense_variant, synonymous_variant
rs879255401 likely-benign, not specified 85,656,485(+) GAGAAGGAGCGCGAGCGCGAG/GAG/GAGAAGGAGCGCGAGCGCGAGAAGGAGCGCGAGCGCGAG coding_sequence_variant, genic_downstream_transcript_variant, inframe_deletion, inframe_insertion
rs1000003078 -- 85,175,928(+) G/T genic_upstream_transcript_variant, intron_variant
rs1000005002 -- 85,351,871(+) T/C genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant
rs1000006062 -- 85,255,413(+) T/C genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for GSE1 Gene

Variant ID Type Subtype PubMed ID
esv2714853 CNV deletion 23290073
esv2714854 CNV deletion 23290073
esv27887 CNV loss 19812545
esv4262 OTHER complex 18987735
nsv1071306 CNV deletion 25765185
nsv1144777 CNV deletion 24896259
nsv483044 CNV gain 15286789
nsv515746 CNV loss 19592680
nsv526299 CNV loss 19592680
nsv952062 CNV deletion 24416366

Variation tolerance for GSE1 Gene

Residual Variation Intolerance Score: 19.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.84; 79.31% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for GSE1 Gene

Human Gene Mutation Database (HGMD)
GSE1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
GSE1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GSE1 Gene

Disorders for GSE1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for GSE1 Gene - From: HGMD and DISEASES

- elite association - COSMIC cancer census association via MalaCards
Search GSE1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for GSE1

genes like me logo Genes that share disorders with GSE1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for GSE1 Gene

Publications for GSE1 Gene

  1. Prediction of the coding sequences of unidentified human genes. V. The coding sequences of 40 new genes (KIAA0161-KIAA0200) deduced by analysis of cDNA clones from human cell line KG-1. (PMID: 8724849) Nagase T … Nomura N (DNA research : an international journal for rapid publication of reports on genes and genomes 1996) 2 3 4 56
  2. GSE1 negative regulation by miR-489-5p promotes breast cancer cell proliferation and invasion. (PMID: 26828271) Chai P … Liu B (Biochemical and biophysical research communications 2016) 3 4 56
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56
  4. A candidate X-linked mental retardation gene is a component of a new family of histone deacetylase-containing complexes. (PMID: 12493763) Hakimi MA … Shiekhattar R (The Journal of biological chemistry 2003) 3 4 56
  5. An AP-MS- and BioID-compatible MAC-tag enables comprehensive mapping of protein interactions and subcellular localizations. (PMID: 29568061) Liu X … Varjosalo M (Nature communications 2018) 3 56

Products for GSE1 Gene

Sources for GSE1 Gene