Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GSC-DT Gene

Subcategory (RNA class) for GSC-DT Gene

non-coding RNA

Quality Score for this RNA gene is

13

Aliases for GSC-DT Gene

  • GSC Divergent Transcript 2 3
  • Divergent To GSC, Induced By TGF-Beta Family Signaling 2 3
  • Divergent To GSC, Induced By TGF-B Family Signaling 3
  • DIGIT 3

External Ids for GSC-DT Gene

Summaries for GSC-DT Gene

GeneCards Summary for GSC-DT Gene

GSC-DT (GSC Divergent Transcript) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with GSC-DT include Short Stature, Auditory Canal Atresia, Mandibular Hypoplasia, And Skeletal Abnormalities.

Additional gene information for GSC-DT Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GSC-DT Gene

Genomics for GSC-DT Gene

Genomic Locations for GSC-DT Gene

Genomic Locations for GSC-DT Gene
chr14:-
(GRCh38/hg38)
Orientation:
Unknown strand

Genomic View for GSC-DT Gene


Cytogenetic band:
GeneLoc Logo Gene Density

RefSeq DNA sequence for GSC-DT Gene

No data available for GeneHancer (GH) Regulatory Elements for GSC-DT Gene

Proteins for GSC-DT Gene

Post-translational modifications for GSC-DT Gene

No Post-translational modifications

No data available for DME Specific Peptides for GSC-DT Gene

Domains & Families for GSC-DT Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for GSC-DT Gene

Function for GSC-DT Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for GSC-DT Gene

Localization for GSC-DT Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for GSC-DT Gene

Pathways & Interactions for GSC-DT Gene

PathCards logo

SuperPathways for GSC-DT Gene

No Data Available

Interacting Proteins for GSC-DT Gene

Gene Ontology (GO) - Biological Process for GSC-DT Gene

None

No data available for Pathways by source and SIGNOR curated interactions for GSC-DT Gene

Drugs & Compounds for GSC-DT Gene

No Compound Related Data Available

Transcripts for GSC-DT Gene

mRNA/cDNA for GSC-DT Gene

(1) RNA Central transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for GSC-DT Gene

No ASD Table

Relevant External Links for GSC-DT Gene

ECgene alternative splicing isoforms for
GSC-DT

Expression for GSC-DT Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for GSC-DT Gene

Orthologs for GSC-DT Gene

No data available for Orthologs and Evolution for GSC-DT Gene

Paralogs for GSC-DT Gene

No data available for Paralogs for GSC-DT Gene

Variants for GSC-DT Gene

Sequence variations from dbSNP and Humsavar for GSC-DT Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs587777288 pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities 94,769,804(+) GCCGGGAGGCCCGCGCCGCCGGG/GCCGGG upstream_transcript_variant
rs587777289 pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities 94,769,173(+) G/A/T upstream_transcript_variant
rs587777290 pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities 94,769,660(+) C/G upstream_transcript_variant
rs1000043986 -- 94,770,369(+) GGGGGG/GGGGG upstream_transcript_variant
rs1000827130 -- 94,773,338(+) G/A non_coding_transcript_variant

Additional Variant Information for GSC-DT Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
GSC-DT

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for GSC-DT Gene

Disorders for GSC-DT Gene

MalaCards: The human disease database

(1) MalaCards diseases for GSC-DT Gene - From: GeneCards

- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for GSC-DT

genes like me logo Genes that share disorders with GSC-DT: view

No data available for UniProtKB/Swiss-Prot and Genatlas for GSC-DT Gene

Publications for GSC-DT Gene

  1. DIGIT Is a Conserved Long Noncoding RNA that Regulates GSC Expression to Control Definitive Endoderm Differentiation of Embryonic Stem Cells. (PMID: 27705785) Daneshvar K … Mullen AC (Cell reports 2016) 2 3 58
  2. LncRNA DIGIT Accelerates Tube Formation of Vascular Endothelial Cells by Sponging miR-134. (PMID: 30158376) Miao C … Wang J (International heart journal 2018) 3 58

Products for GSC-DT Gene

Sources for GSC-DT Gene

Content
Loading form....