GRM6 Gene (Protein Coding)

Glutamate Metabotropic Receptor 6

GC05M178978
GIFtS:
48
L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that ... See more...

Aliases for GRM6 Gene

Aliases for GRM6 Gene

  • Glutamate Metabotropic Receptor 6 2 3 5
  • Glutamate Receptor, Metabotropic 6 2 3
  • Metabotropic Glutamate Receptor 6 3 4
  • GPRC1F 3 4
  • MGLUR6 3 4
  • CSNB1B 3
  • MGluR6 4
  • MGlu6 3

External Ids for GRM6 Gene

Previous GeneCards Identifiers for GRM6 Gene

  • GC05M178429
  • GC05M179301
  • GC05M178505
  • GC05M178324
  • GC05M178392
  • GC05M173132

Summaries for GRM6 Gene

Entrez Gene Summary for GRM6 Gene

  • L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Mutations in this gene result in congenital stationary night blindness type 1B. [provided by RefSeq, May 2018]

GeneCards Summary for GRM6 Gene

GRM6 (Glutamate Metabotropic Receptor 6) is a Protein Coding gene. Diseases associated with GRM6 include Night Blindness, Congenital Stationary, Type 1B and Congenital Stationary Night Blindness. Among its related pathways are Peptide ligand-binding receptors and Phospholipase D signaling pathway. Gene Ontology (GO) annotations related to this gene include G protein-coupled receptor activity and glutamate receptor activity. An important paralog of this gene is GRM8.

UniProtKB/Swiss-Prot Summary for GRM6 Gene

  • G-protein coupled receptor for glutamate. Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors, such as adenylate cyclase. Signaling inhibits adenylate cyclase activity (By similarity). Signaling stimulates TRPM1 channel activity and Ca(2+) uptake. Required for normal vision.

Tocris Summary for GRM6 Gene

  • Metabotropic Glutamate (mGlu) group III receptors are members of the metabotropic class of glutamate receptors, which also includes mGlu group I and mGlu group II receptors. Group III receptors are divided into four subtypes, mGlu4, mGlu6, mGlu7 and mGlu8.

Gene Wiki entry for GRM6 Gene

Additional gene information for GRM6 Gene

No data available for CIViC Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for GRM6 Gene

Genomics for GRM6 Gene

GeneHancer (GH) Regulatory Elements for GRM6 Gene

Promoters and enhancers for GRM6 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH05J178992 Promoter 0.4 Ensembl 750.6 +1.2 1205 0.4 EZH2 GRM6 lnc-GRM6-2 lnc-ADAMTS2-3
GH05J179619 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 50.7 -625.9 -625866 6.5 ZNF785 SIN3A ZBTB40 SP1 CTCF SREBF1 FOXA1 MLX RBPJ SMARCE1 HNRNPH1 lnc-C5orf60-3 ZNF879 MRNIP MAML1 CNOT6 ZFP2 GRM6 ENSG00000254035 ZNF354C
GH05J179696 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 23 -702.7 -702739 4.9 ZBTB40 SP1 ZBTB6 RBPJ SMARCE1 POLR2A CEBPZ USF2 ATF1 FOS CANX lnc-CBY3-2 lnc-CBY3-4 MAML1 ZNF354B CNOT6 MRNIP HNRNPH1 ZNF879 ZNF354C
GH05J178229 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 22.3 +763.8 763810 4.8 ZNF24 ZBTB40 ZBTB6 POLR2A MYC ELF1 HLF L3MBTL2 MAX ZNF121 PHYKPL piR-43839 ZFP2 ENSG00000254035 GRM6 ZNF454 ZNF879 GMCL2 ENSG00000249186 OR1X5P
GH05J178203 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 11.4 +785.8 785806 14 SIN3A SP1 ZBTB6 RBPJ POLR2A CTBP1 FOS HCFC1 ZNF362 MYC HNRNPAB ENSG00000247679 FAM193B ZNF879 ENSG00000246596 ZNF354C MXD3 ZNF454 LMAN2 ZFP2
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GRM6 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the GRM6 gene promoter:
  • AhR
  • AML1a
  • c-Myb
  • CREB
  • CUTL1
  • deltaCREB
  • Egr-2
  • PPAR-gamma1
  • PPAR-gamma2
  • RFX1

Genomic Locations for GRM6 Gene

Genomic Locations for GRM6 Gene
chr5:178,977,587-178,996,206
(GRCh38/hg38)
Size:
18,620 bases
Orientation:
Minus strand
chr5:178,405,328-178,423,207
(GRCh37/hg19)
Size:
17,880 bases
Orientation:
Minus strand

Genomic View for GRM6 Gene

Genes around GRM6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GRM6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GRM6 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for GRM6 Gene

Proteins for GRM6 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for GRM6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O15303-GRM6_HUMAN
    Recommended name:
    Metabotropic glutamate receptor 6
    Protein Accession:
    O15303

    Protein attributes for GRM6 Gene

    Size:
    877 amino acids
    Molecular mass:
    95468 Da
    Quaternary structure:
    • Homodimer.

neXtProt entry for GRM6 Gene

Protein Expression for GRM6 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for GRM6 Gene

  • Glycosylation at Asn296, Asn451, Asn479, and Asn567
  • Modification sites at PhosphoSitePlus

Other Protein References for GRM6 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for GRM6 Gene

Domains & Families for GRM6 Gene

Gene Families for GRM6 Gene

HGNC:
IUPHAR :
Human Protein Atlas (HPA):
  • Disease related genes
  • G-protein coupled receptors
  • Potential drug targets
  • Predicted membrane proteins

Protein Domains for GRM6 Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for GRM6 Gene

GenScript: Design optimal peptide antigens:
  • Metabotropic glutamate receptor 6 (GRM6_HUMAN)
  • Putative truncated metabotropic glutamate receptor 6 form b (Q9UGK1_HUMAN)
  • Putative truncated metabotropic glutamate receptor 6 form a (Q9UGK2_HUMAN)

Graphical View of Domain Structure for InterPro Entry

O15303

UniProtKB/Swiss-Prot:

GRM6_HUMAN :
  • Belongs to the G-protein coupled receptor 3 family.
Family:
  • Belongs to the G-protein coupled receptor 3 family.
genes like me logo Genes that share domains with GRM6: view

Function for GRM6 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for GRM6 Gene

UniProtKB/Swiss-Prot Function:
G-protein coupled receptor for glutamate. Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors, such as adenylate cyclase. Signaling inhibits adenylate cyclase activity (By similarity). Signaling stimulates TRPM1 channel activity and Ca(2+) uptake. Required for normal vision.
GENATLAS Biochemistry:
metabotropic glutamate receptor 6,groupe III,G protein coupled receptor superfamily,restrictidly expressed in retinal bipolar cells,linked to the inhibition of cAMP cascade

Phenotypes From GWAS Catalog for GRM6 Gene

Gene Ontology (GO) - Molecular Function for GRM6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001640 adenylate cyclase inhibiting G protein-coupled glutamate receptor activity IEA --
GO:0004930 G protein-coupled receptor activity TAS 9215706
GO:0005515 protein binding IPI 17405131
GO:0008066 glutamate receptor activity TAS 9215706
GO:0042803 protein homodimerization activity IPI 17405131
genes like me logo Genes that share ontologies with GRM6: view
genes like me logo Genes that share phenotypes with GRM6: view

Human Phenotype Ontology for GRM6 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for GRM6 Gene

MGI Knock Outs for GRM6:
  • Grm6 Grm6<tm1b(EUCOMM)Wtsi>
  • Grm6 Grm6<tm1Nak>

Animal Model Products

CRISPR Products

Clone Products

  • Addgene plasmids for GRM6

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for GRM6 Gene

Localization for GRM6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for GRM6 Gene

Cell membrane; Multi-pass membrane protein. Endoplasmic reticulum membrane; Multi-pass membrane protein. Golgi apparatus membrane; Multi-pass membrane protein. Cell projection, dendrite. Note=Subject to trafficking from the endoplasmic reticulum to the Golgi apparatus and then to the cell membrane.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GRM6 gene
Compartment Confidence
plasma membrane 5
endoplasmic reticulum 5
golgi apparatus 5
extracellular 1
cytoskeleton 1

Gene Ontology (GO) - Cellular Components for GRM6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane IDA 17405131
GO:0005783 endoplasmic reticulum IEA --
GO:0005789 endoplasmic reticulum membrane IDA,IEA 17405131
GO:0005794 Golgi apparatus IEA --
GO:0005886 plasma membrane TAS --
genes like me logo Genes that share ontologies with GRM6: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for GRM6 Gene

Pathways & Interactions for GRM6 Gene

genes like me logo Genes that share pathways with GRM6: view

Pathways by source for GRM6 Gene

1 BioSystems pathway for GRM6 Gene
3 Qiagen pathways for GRM6 Gene
  • CREB Pathway
  • Neuropathic Pain-Signaling in Dorsal Horn Neurons
  • Signaling in Gap Junctions

Gene Ontology (GO) - Biological Process for GRM6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007165 signal transduction IEA --
GO:0007186 G protein-coupled receptor signaling pathway TAS --
GO:0007196 adenylate cyclase-inhibiting G protein-coupled glutamate receptor signaling pathway IBA 21873635
GO:0007216 G protein-coupled glutamate receptor signaling pathway TAS,IMP 23452348
GO:0007268 chemical synaptic transmission IEA --
genes like me logo Genes that share ontologies with GRM6: view

No data available for SIGNOR curated interactions for GRM6 Gene

Drugs & Compounds for GRM6 Gene

Products:

  1. Drug

(115) Drugs for GRM6 Gene - From: ApexBio, DGIdb, IUPHAR, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Glutamic acid Approved Nutra Full agonist, Agonist, antagonist 281
Spaglumic acid Experimental Pharma Selective mGlu3 agonist 0
Fenobam Investigational Pharma Negative, Allosteric regulator 0
Kynurenic acid Investigational Pharma Agonist 4
L-AP4 Pharma Full agonist, Agonist Selective group III mGlu agonist 0

(4) Additional Compounds for GRM6 Gene - From: IUPHAR and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
(2<i>S</i>,1<i>S</i>,2<i>S</i>)-L-CCG-I
Full agonist, Agonist
L-SOP
Full agonist, Agonist

(5) Tocris Compounds for GRM6 Gene

Compound Action Cas Number
(RS)-PPG Potent, selective mGlu8 agonist 120667-15-4
(S)-3,4-DCPG Potent, selective mGlu8a agonist 201730-11-2
ACPT-I Group III mGlu agonist 194918-76-8
L-AP4 Selective group III mGlu agonist 23052-81-5
O-Phospho-L-serine Group III mGlu agonist 407-41-0

(101) ApexBio Compounds for GRM6 Gene

Compound Action Cas Number
(±)-LY 395756 852679-66-4
(±)-trans-ACPD 67684-64-4
(1S,3R)-ACPD 111900-32-4
(R)-3,4-DCPG 201730-10-1
(R)-3-Carboxy-4-hydroxyphenylglycine 13861-03-5
(RS)-3,4-DCPG 176796-64-8
(RS)-3,5-DHPG 19641-83-9
(RS)-3-Hydroxyphenylglycine 31932-87-3
(RS)-4-Carboxy-3-hydroxyphenylglycine 134052-66-7
(RS)-4-Carboxyphenylglycine 7292-81-1
(RS)-APICA 170847-18-4
(RS)-MCPG 146669-29-6
(RS)-MCPG disodium salt 1303994-09-3
(RS)-PPG 120667-15-4
(S)-3,4-DCPG 201730-11-2
(S)-3,5-DHPG 162870-29-3
(S)-3-Carboxy-4-hydroxyphenylglycine 55136-48-6
(S)-3-Hydroxyphenylglycine 71301-82-1
(S)-4-Carboxy-3-hydroxyphenylglycine 85148-82-9
(S)-4-Carboxyphenylglycine 134052-73-6
(S)-HexylHIBO 334887-48-8
(S)-MCPG 150145-89-4
2,4-Dihydroxyphenylacetyl-L-asparagine 111872-98-1
3-MATIDA 518357-51-2
ACDPP hydrochloride 37804-11-8
ACPT-I 194918-76-8
AIDA 168560-79-0
BINA 866823-73-6
CBiPES hydrochloride 856702-40-4
CDPPB 781652-57-1
CHPG Sodium salt 1303993-73-8
Cinnabarinic acid 606-59-7
CPCCOEt 179067-99-3
CPPG 183364-82-1
D-AP4 78739-01-2
DCB 6971-97-7
DCG IV 147782-19-2
Desmethyl-YM 298198 1177767-57-5
DFB 15332-10-2
DL-AP4 20263-07-4
DL-AP4 Sodium salt 1263093-79-3
DMeOB 40252-74-2
E4CPG 170846-89-6
EGLU 170984-72-2
Fenobam 57653-26-6
HexylHIBO 334887-43-3
JNJ 16259685 409345-29-5
Kynurenic acid 492-27-3
Kynurenic acid sodium salt 2439-02-3
L-AP4 23052-81-5
L-AP6 78944-89-5
L-BMAA hydrochloride 16012-55-8
L-CCG-l 117857-93-9
LY 2389575 hydrochloride 885104-09-6
LY 354740 176199-48-7
LY 379268 disodium salt
LY 456236 hydrochloride 338736-46-2
LY 487379 hydrochloride 353229-59-1
MAP4 157381-42-5
MFZ 10-7 1224431-15-5
ML 289 1382481-79-9
ML 337 1443118-44-2
MMPIP hydrochloride 479077-02-6
MNI 137 946619-21-2
MNI-caged-L-glutamate 295325-62-1
MSOP 66515-29-5
MSPG 169209-64-7
MTPG 169209-66-9
N-Acetylglycyl-D-glutamic acid 135701-69-8
NPEC-caged-(1S,3R)-ACPD 1315379-60-2
NPEC-caged-(S)-3,4-DCPG 1257323-85-5
NPEC-caged-LY 379268
NPS 2390 226878-01-9
O-Phospho-L-serine 407-41-0
PHCCC 179068-02-1
Ro 01-6128 302841-86-7
Ro 64-5229 246852-46-0
Ro 67-4853 302841-89-0
Ro 67-7476 298690-60-5
RuBi-Glutamate
Salsolinol-1-carboxylic acid 57256-34-5
SIB 1757 31993-01-8
SIB 1893 6266-99-5
Spaglumic acid 3106-85-2
S-Sulfo-L-cysteine sodium salt 7381-67-1
TC-N 22A 1314140-00-5
TCN 238 125404-04-8
UBP1112 339526-74-8
VU 0155041 1093757-42-6
VU 0155041 sodium salt 1259372-69-4
VU 0285683 327056-22-4
VU 0360172 hydrochloride 1309976-62-2
VU 0360223 1274859-33-4
VU 1545 890764-63-3
VU 29 890764-36-0
Xanthurenic acid 59-00-7
YM 202074 299900-84-8
YM 230888 446257-23-4
YM 298198 hydrochloride 1216398-09-2
Z-Cyclopentyl-AP4 103439-17-4
γDGG 6729-55-1
genes like me logo Genes that share compounds with GRM6: view

Drug Products

Transcripts for GRM6 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for GRM6 Gene

(1) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(8) Selected AceView cDNA sequences:
(6) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

  • Addgene plasmids for GRM6

Alternative Splicing Database (ASD) splice patterns (SP) for GRM6 Gene

No ASD Table

Relevant External Links for GRM6 Gene

GeneLoc Exon Structure for
GRM6
ECgene alternative splicing isoforms for
GRM6

Expression for GRM6 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GRM6 Gene

mRNA expression in normal human tissues for GRM6 Gene
mRNA expression by GTEx for GRM6 GenemRNA expression by BioGPS for GRM6 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for GRM6 Gene

This gene is overexpressed in Pituitary (x5.1) and Testis (x4.3).

Protein differential expression in normal tissues from HIPED for GRM6 Gene

This gene is overexpressed in Frontal cortex (31.9), Seminal vesicle (28.3), and Retina (8.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for GRM6 Gene



Protein tissue co-expression partners for GRM6 Gene

NURSA nuclear receptor signaling pathways regulating expression of GRM6 Gene:

GRM6

SOURCE GeneReport for Unigene cluster for GRM6 Gene:

Hs.248131

mRNA Expression by UniProt/SwissProt for GRM6 Gene:

O15303-GRM6_HUMAN
Tissue specificity: Detected in melanocytes.

Evidence on tissue expression from TISSUES for GRM6 Gene

  • Eye(2.8)
  • Nervous system(2.6)

Phenotype-based relationships between genes and organs from Gene ORGANizer for GRM6 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • immune
  • integumentary
  • nervous
  • skeletal muscle
Regions:
Head and neck:
  • brain
  • cranial nerve
  • eye
  • head
General:
  • blood
  • peripheral nervous system
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with GRM6: view

Orthologs for GRM6 Gene

This gene was present in the common ancestor of animals.

Orthologs for GRM6 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia GRM6 33 32
  • 99.01 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia GRM6 33 32
  • 91.1 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia GRM6 33 32
  • 90.45 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Grm6 32
  • 88.2 (n)
mouse
(Mus musculus)
 Mammalia Grm6 17 33 32
  • 88.04 (n)
oppossum
(Monodelphis domestica)
 Mammalia GRM6 33
  • 84 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia GRM6 33
  • 79 (a)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia GRM6 33
  • 74 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia grm8 32
  • 76.09 (n)
zebrafish
(Danio rerio)
 Actinopterygii grm6b 33 32
  • 71.46 (n)
 OneToMany
grm6a 33
  • 70 (a)
 OneToMany
fruit fly
(Drosophila melanogaster)
 Insecta Glu-RA 34
  • 44 (a)
CG30361 34
  • 42 (a)
worm
(Caenorhabditis elegans)
 Secernentea mgl-1 34
  • 37 (a)
Species where no ortholog for GRM6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for GRM6 Gene

ENSEMBL:
Gene Tree for GRM6 (if available)
TreeFam:
Gene Tree for GRM6 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for GRM6: view image

Paralogs for GRM6 Gene

Paralogs for GRM6 Gene

(9) SIMAP similar genes for GRM6 Gene using alignment to 1 proteins:

  • GRM6_HUMAN
genes like me logo Genes that share paralogs with GRM6: view

Variants for GRM6 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for GRM6 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs11746675 not-provided, benign, not provided, not specified 178,986,946(-) T/C coding_sequence_variant, synonymous_variant
rs121434304 pathogenic, likely-pathogenic, Congenital stationary night blindness, type 1B, not provided, Night blindness, congenital stationary, 1B (CSNB1B) [MIM:257270] 178,989,075(-) A/G/T coding_sequence_variant, missense_variant
rs1237461749 likely-pathogenic, Congenital stationary night blindness 178,994,813(-) CAGGCCGCCCAGCGTCAGGCCGCCC/CAGGCCGCCC/CAGGCCGCCCAGCGTCAGGCCGCCCAGCGTCAGGCCGCCC coding_sequence_variant, inframe_deletion, inframe_insertion
rs17078874 not-provided, not provided, - 178,982,926(-) G/A coding_sequence_variant, missense_variant
rs17078877 not-provided, not provided, - 178,983,212(-) T/A/C coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for GRM6 Gene

Variant ID Type Subtype PubMed ID
dgv364n21 CNV loss 19592680
nsv1119057 CNV deletion 24896259
nsv1120062 OTHER inversion 24896259
nsv600489 CNV loss 21841781
nsv600490 CNV loss 21841781
nsv950734 CNV deletion 24416366

Variation tolerance for GRM6 Gene

Residual Variation Intolerance Score: 94.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.01; 74.91% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for GRM6 Gene

Human Gene Mutation Database (HGMD)
GRM6
SNPedia medical, phenotypic, and genealogical associations of SNPs for
GRM6

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GRM6 Gene

Disorders for GRM6 Gene

MalaCards: The human disease database

(9) MalaCards diseases for GRM6 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search GRM6 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

GRM6_HUMAN
  • Night blindness, congenital stationary, 1B (CSNB1B) [MIM:257270]: A non-progressive retinal disorder characterized by impaired night vision. Congenital stationary night blindness type 1B is an autosomal recessive form associated with a negative electroretinogram waveform. Patients are night blind from an early age, and when maximally dark-adapted, they could perceive lights only with an intensity equal to or slightly dimmer than that normally detected by the cone system. ERGs in response to single brief flashes of light have clearly detectable a-waves, which are derived from photoreceptors, and greatly reduced b-waves, which are derived from the second-order inner retinal neurons. ERGs in response to sawtooth flickering light indicate a markedly reduced on response and a nearly normal OFF response. There is no subjective delay in the perception of suddenly appearing white vs black objects on a gray background. {ECO:0000269 PubMed:15781871, ECO:0000269 PubMed:17405131, ECO:0000269 PubMed:23714322}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for GRM6

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with GRM6: view

No data available for Genatlas for GRM6 Gene

Publications for GRM6 Gene

  1. The whole nucleotide sequence and chromosomal localization of the gene for human metabotropic glutamate receptor subtype 6. (PMID: 9215706) Hashimoto T … Nakanishi S (The European journal of neuroscience 1997) 2 3 4 23 56
  2. Sequence variations of GRM6 in patients with high myopia. (PMID: 19862333) Xu X … Zhang Q (Molecular vision 2009) 3 23 43 56
  3. Night blindness-associated mutations in the ligand-binding, cysteine-rich, and intracellular domains of the metabotropic glutamate receptor 6 abolish protein trafficking. (PMID: 17405131) Zeitz C … Berger W (Human mutation 2007) 3 4 23 56
  4. Night blindness and abnormal cone electroretinogram ON responses in patients with mutations in the GRM6 gene encoding mGluR6. (PMID: 15781871) Dryja TP … Rajagopalan AS (Proceedings of the National Academy of Sciences of the United States of America 2005) 3 4 23 56
  5. Genotype and phenotype of 101 dutch patients with congenital stationary night blindness. (PMID: 23714322) Bijveld MM … van Genderen MM (Ophthalmology 2013) 3 4 56

ExternalLinks

View latest publications for GRM6 gene in Mastermind

Products for GRM6 Gene

  • Addgene plasmids for GRM6

Sources for GRM6 Gene