Free for academic non-profit institutions. Other users need a Commercial license
L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Mutations in this gene result in congenital stationary night blindness type 1B. [provided by RefSeq, May 2018]
GRM6 (Glutamate Metabotropic Receptor 6) is a Protein Coding gene. Diseases associated with GRM6 include Night Blindness, Congenital Stationary, Type 1B and Congenital Stationary Night Blindness. Among its related pathways are Peptide ligand-binding receptors and Phospholipase D signaling pathway. Gene Ontology (GO) annotations related to this gene include G protein-coupled receptor activity and glutamate receptor activity. An important paralog of this gene is GRM8.
Metabotropic Glutamate (mGlu) group III receptors are members of the metabotropic class of glutamate receptors, which also includes mGlu group I and mGlu group II receptors. Group III receptors are divided into four subtypes, mGlu4, mGlu6, mGlu7 and mGlu8.
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0001640 | adenylate cyclase inhibiting G protein-coupled glutamate receptor activity | IEA | -- |
GO:0004930 | G protein-coupled receptor activity | TAS | 9215706 |
GO:0005515 | protein binding | IPI | 17405131 |
GO:0008066 | glutamate receptor activity | TAS | 9215706 |
GO:0042803 | protein homodimerization activity | IPI | 17405131 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000139 | Golgi membrane | IDA | 17405131 |
GO:0005783 | endoplasmic reticulum | IEA | -- |
GO:0005789 | endoplasmic reticulum membrane | IDA,IEA | 17405131 |
GO:0005794 | Golgi apparatus | IEA | -- |
GO:0005886 | plasma membrane | TAS | -- |
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Peptide ligand-binding receptors | ||
2 | Signaling by GPCR | ||
3 | Circadian entrainment | ||
4 | Phospholipase D signaling pathway | ||
5 | CREB Pathway |
CREB Pathway
.68
|
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0007165 | signal transduction | IEA | -- |
GO:0007186 | G protein-coupled receptor signaling pathway | TAS | -- |
GO:0007196 | adenylate cyclase-inhibiting G protein-coupled glutamate receptor signaling pathway | IBA | 21873635 |
GO:0007216 | G protein-coupled glutamate receptor signaling pathway | TAS,IMP | 23452348 |
GO:0007268 | chemical synaptic transmission | IEA | -- |
Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
---|---|---|---|---|---|---|
Glutamic acid | Approved | Nutra | Full agonist, Agonist, antagonist | 281 | ||
Spaglumic acid | Experimental | Pharma | Selective mGlu3 agonist | 0 | ||
Fenobam | Investigational | Pharma | Negative, Allosteric regulator | 0 | ||
Kynurenic acid | Investigational | Pharma | Agonist | 4 | ||
L-AP4 | Pharma | Full agonist, Agonist | Selective group III mGlu agonist | 0 |
Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs | |
---|---|---|---|---|---|---|
(2<i>S</i>,1<i>S</i>,2<i>S</i>)-L-CCG-I |
|
Full agonist, Agonist |
|
|||
L-SOP |
|
Full agonist, Agonist |
|
Compound | Action | Cas Number |
---|---|---|
(RS)-PPG | Potent, selective mGlu8 agonist | 120667-15-4 |
(S)-3,4-DCPG | Potent, selective mGlu8a agonist | 201730-11-2 |
ACPT-I | Group III mGlu agonist | 194918-76-8 |
L-AP4 | Selective group III mGlu agonist | 23052-81-5 |
O-Phospho-L-serine | Group III mGlu agonist | 407-41-0 |
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | GRM6 33 32 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | GRM6 33 32 |
|
OneToOne | |
cow (Bos Taurus) |
Mammalia | GRM6 33 32 |
|
OneToOne | |
rat (Rattus norvegicus) |
Mammalia | Grm6 32 |
|
||
mouse (Mus musculus) |
Mammalia | Grm6 17 33 32 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | GRM6 33 |
|
OneToOne | |
platypus (Ornithorhynchus anatinus) |
Mammalia | GRM6 33 |
|
OneToOne | |
lizard (Anolis carolinensis) |
Reptilia | GRM6 33 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | grm8 32 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | grm6b 33 32 |
|
OneToMany | |
grm6a 33 |
|
OneToMany | |||
fruit fly (Drosophila melanogaster) |
Insecta | Glu-RA 34 |
|
|
|
CG30361 34 |
|
|
|||
worm (Caenorhabditis elegans) |
Secernentea | mgl-1 34 |
|
|
SNP ID | Clin | Chr 05 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs11746675 | not-provided, benign, not provided, not specified | 178,986,946(-) | T/C | coding_sequence_variant, synonymous_variant | |
rs121434304 | pathogenic, likely-pathogenic, Congenital stationary night blindness, type 1B, not provided, Night blindness, congenital stationary, 1B (CSNB1B) [MIM:257270] | 178,989,075(-) | A/G/T | coding_sequence_variant, missense_variant | |
rs1237461749 | likely-pathogenic, Congenital stationary night blindness | 178,994,813(-) | CAGGCCGCCCAGCGTCAGGCCGCCC/CAGGCCGCCC/CAGGCCGCCCAGCGTCAGGCCGCCCAGCGTCAGGCCGCCC | coding_sequence_variant, inframe_deletion, inframe_insertion | |
rs17078874 | not-provided, not provided, - | 178,982,926(-) | G/A | coding_sequence_variant, missense_variant | |
rs17078877 | not-provided, not provided, - | 178,983,212(-) | T/A/C | coding_sequence_variant, missense_variant |
Disorder | Aliases | PubMed IDs |
---|---|---|
night blindness, congenital stationary, type 1b |
|
|
congenital stationary night blindness |
|
|
leber congenital amaurosis |
|
|
night blindness |
|
|
suppression amblyopia |
|
|