Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GRIP2 Gene

Aliases for GRIP2 Gene

  • Glutamate Receptor Interacting Protein 2 2 3 5
  • Glutamate Receptor-Interacting Protein 2 3
  • KIAA1719 4
  • GRIP-2 4

External Ids for GRIP2 Gene

Previous GeneCards Identifiers for GRIP2 Gene

  • GC03M014505

Summaries for GRIP2 Gene

GeneCards Summary for GRIP2 Gene

GRIP2 (Glutamate Receptor Interacting Protein 2) is a Protein Coding gene. Among its related pathways are Glutamate Binding, Activation of AMPA Receptors and Synaptic Plasticity and Transmission across Chemical Synapses. Gene Ontology (GO) annotations related to this gene include protein C-terminus binding and receptor signaling complex scaffold activity. An important paralog of this gene is GRIP1.

UniProtKB/Swiss-Prot for GRIP2 Gene

  • May play a role as a localized scaffold for the assembly of a multiprotein signaling complex and as mediator of the trafficking of its binding partners at specific subcellular location in neurons.

Gene Wiki entry for GRIP2 Gene

Additional gene information for GRIP2 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GRIP2 Gene

Genomics for GRIP2 Gene

GeneHancer (GH) Regulatory Elements for GRIP2 Gene

Promoters and enhancers for GRIP2 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J014540 Promoter/Enhancer 1 EPDnew dbSUPER 650.2 +62.6 62608 0.1 ZFHX2 KLF17 ZIC2 EGR2 GRIP2 RNU6-905P GC03M014534 GC03P014564
GH03J014602 Promoter 0.8 EPDnew 650.7 0.0 -12 0.1 E2F1 ZFHX2 MXI1 EGR2 GRIP2 LOC105376960 PIR36019
GH03J014601 Enhancer 0.6 ENCODE 650.7 +1.0 997 0.1 CTCF ZNF10 ZIC2 ZNF335 XRCC5 GLIS1 PRDM4 ZXDB EZH2 LOC105376960 GRIP2
GH03J014521 Enhancer 1.1 Ensembl ENCODE dbSUPER 25 +78.9 78906 6.1 BCOR ZBTB6 INSM2 ZMYM3 CEBPG ZBTB7B FOSL1 ZFHX2 EGR1 ADNP GRIP2 RNU6-905P GC03M014534 GC03P014432
GH03J014508 Enhancer 0.9 Ensembl ENCODE 26.7 +93.8 93762 0.9 CTCF KLF1 ZNF792 KLF17 PYGO2 KLF14 RAD21 ZKSCAN1 CC2D1A ZFHX2 GRIP2 RNU6-905P GC03M014534 GC03P014432
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GRIP2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the GRIP2 gene promoter:
  • POU2F1b
  • POU2F1a
  • POU2F1
  • Brachyury
  • POU2F1c
  • FOXO1
  • FOXO1a
  • AML1a
  • HOXA3
  • c-Jun

Genomic Locations for GRIP2 Gene

Genomic Locations for GRIP2 Gene
chr3:14,489,111-14,602,996
(GRCh38/hg38)
Size:
113,886 bases
Orientation:
Minus strand
chr3:14,530,619-14,583,588
(GRCh37/hg19)
Size:
52,970 bases
Orientation:
Minus strand

Genomic View for GRIP2 Gene

Genes around GRIP2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GRIP2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GRIP2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GRIP2 Gene

Proteins for GRIP2 Gene

  • Protein details for GRIP2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9C0E4-GRIP2_HUMAN
    Recommended name:
    Glutamate receptor-interacting protein 2
    Protein Accession:
    Q9C0E4
    Secondary Accessions:
    • A0A087WU38
    • Q8TEH9
    • Q9H7H3

    Protein attributes for GRIP2 Gene

    Size:
    1043 amino acids
    Molecular mass:
    112573 Da
    Quaternary structure:
    • Interacts with EFNB1, EFNB3, GRIA2, GRIA3, CSPG4 and GRIPAP1. Can form homomultimers and heteromultimers with GRIP1 (By similarity). Interacts with the C-terminal tail of PRLHR.
    SequenceCaution:
    • Sequence=BAB21810.2; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for GRIP2 Gene

    Alternative splice isoforms for GRIP2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for GRIP2 Gene

Post-translational modifications for GRIP2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for GRIP2 Gene

Domains & Families for GRIP2 Gene

Gene Families for GRIP2 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for GRIP2 Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for GRIP2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9C0E4

UniProtKB/Swiss-Prot:

GRIP2_HUMAN :
  • PDZ 5 mediates the C-terminal binding of GRIA2 and GRIA3. PDZ 6 mediates interaction with the PDZ recognition motif of EFNB1. PDZ 7 mediates interaction with CSPG4 (By similarity).
  • Belongs to the GRIP2 family.
Domain:
  • PDZ 5 mediates the C-terminal binding of GRIA2 and GRIA3. PDZ 6 mediates interaction with the PDZ recognition motif of EFNB1. PDZ 7 mediates interaction with CSPG4 (By similarity).
Family:
  • Belongs to the GRIP2 family.
genes like me logo Genes that share domains with GRIP2: view

Function for GRIP2 Gene

Molecular function for GRIP2 Gene

UniProtKB/Swiss-Prot Function:
May play a role as a localized scaffold for the assembly of a multiprotein signaling complex and as mediator of the trafficking of its binding partners at specific subcellular location in neurons.

Phenotypes From GWAS Catalog for GRIP2 Gene

Gene Ontology (GO) - Molecular Function for GRIP2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0030159 receptor signaling complex scaffold activity IEA --
genes like me logo Genes that share ontologies with GRIP2: view
genes like me logo Genes that share phenotypes with GRIP2: view

Animal Models for GRIP2 Gene

MGI Knock Outs for GRIP2:

Animal Model Products

miRNA for GRIP2 Gene

miRTarBase miRNAs that target GRIP2

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for GRIP2 Gene

Localization for GRIP2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for GRIP2 Gene

Cytoplasm. Membrane; Peripheral membrane protein.

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for GRIP2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
GO:0005886 plasma membrane TAS --
GO:0014069 postsynaptic density IEA --
GO:0016020 membrane IEA --
GO:0030425 dendrite IEA --
genes like me logo Genes that share ontologies with GRIP2: view

No data available for Subcellular locations from COMPARTMENTS for GRIP2 Gene

Pathways & Interactions for GRIP2 Gene

genes like me logo Genes that share pathways with GRIP2: view

Interacting Proteins for GRIP2 Gene

Gene Ontology (GO) - Biological Process for GRIP2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007219 Notch signaling pathway IEA --
GO:0014824 artery smooth muscle contraction IEA --
GO:0015031 protein transport IEA --
GO:0045777 positive regulation of blood pressure IEA --
genes like me logo Genes that share ontologies with GRIP2: view

No data available for SIGNOR curated interactions for GRIP2 Gene

Drugs & Compounds for GRIP2 Gene

No Compound Related Data Available

Transcripts for GRIP2 Gene

Unigene Clusters for GRIP2 Gene

Glutamate receptor interacting protein 2:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for GRIP2 Gene

ExUns: 1a · 1b ^ 2a · 2b ^ 3 ^ 4 ^ 5a · 5b ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9 ^ 10a · 10b · 10c ^ 11 ^ 12
SP1: - -
SP2: - -
SP3: -
SP4:
SP5:
SP6:

Relevant External Links for GRIP2 Gene

GeneLoc Exon Structure for
GRIP2
ECgene alternative splicing isoforms for
GRIP2

Expression for GRIP2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GRIP2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for GRIP2 Gene

This gene is overexpressed in Heart - Left Ventricle (x6.7) and Muscle - Skeletal (x5.8).

Protein differential expression in normal tissues from HIPED for GRIP2 Gene

This gene is overexpressed in Heart (68.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for GRIP2 Gene



Protein tissue co-expression partners for GRIP2 Gene

NURSA nuclear receptor signaling pathways regulating expression of GRIP2 Gene:

GRIP2

SOURCE GeneReport for Unigene cluster for GRIP2 Gene:

Hs.517819
genes like me logo Genes that share expression patterns with GRIP2: view

No data available for mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for GRIP2 Gene

Orthologs for GRIP2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for GRIP2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia GRIP2 33
  • 98.8 (n)
dog
(Canis familiaris)
Mammalia GRIP2 33
  • 89.49 (n)
cow
(Bos Taurus)
Mammalia GRIP2 33
  • 88.1 (n)
rat
(Rattus norvegicus)
Mammalia Grip2 33
  • 83.61 (n)
mouse
(Mus musculus)
Mammalia Grip2 16 33
  • 83.46 (n)
chicken
(Gallus gallus)
Aves GRIP2 33
  • 72.4 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia grip2 33
  • 69.35 (n)
zebrafish
(Danio rerio)
Actinopterygii grip2b 33
  • 66.53 (n)
wufi03h07 33
Species where no ortholog for GRIP2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for GRIP2 Gene

ENSEMBL:
Gene Tree for GRIP2 (if available)
TreeFam:
Gene Tree for GRIP2 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for GRIP2: view image

Paralogs for GRIP2 Gene

Paralogs for GRIP2 Gene

(1) SIMAP similar genes for GRIP2 Gene using alignment to 1 proteins:

  • GRIP2_HUMAN
genes like me logo Genes that share paralogs with GRIP2: view

Variants for GRIP2 Gene

Sequence variations from dbSNP and Humsavar for GRIP2 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1000080840 -- 14,561,851(-) C/T genic_upstream_transcript_variant, intron_variant
rs1000088426 -- 14,574,129(-) C/T genic_upstream_transcript_variant, intron_variant
rs1000104045 -- 14,599,719(-) G/T genic_upstream_transcript_variant, intron_variant
rs1000138939 -- 14,567,545(-) A/C genic_upstream_transcript_variant, intron_variant
rs1000156591 -- 14,540,424(-) GGGCACCGAGTCCACCCACTGCAGCGGGC/GGGC genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for GRIP2 Gene

Variant ID Type Subtype PubMed ID
esv2724945 CNV deletion 23290073
nsv1072671 CNV deletion 25765185
nsv1123628 CNV deletion 24896259
nsv3712 CNV insertion 18451855
nsv460447 CNV loss 19166990
nsv470427 CNV loss 18288195
nsv518216 CNV loss 19592680
nsv521453 CNV loss 19592680
nsv525798 CNV gain 19592680
nsv589772 CNV loss 21841781
nsv822002 CNV gain 20364138

Additional Variant Information for GRIP2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
GRIP2

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for GRIP2 Gene

Disorders for GRIP2 Gene

Additional Disease Information for GRIP2

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for GRIP2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for GRIP2 Gene

Publications for GRIP2 Gene

  1. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  2. A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB. (PMID: 19734545) Need AC … Goldstein DB (Human molecular genetics 2009) 3 44 58
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  4. Construction of expression-ready cDNA clones for KIAA genes: manual curation of 330 KIAA cDNA clones. (PMID: 12168954) Nakajima D … Nagase T (DNA research : an international journal for rapid publication of reports on genes and genomes 2002) 3 4 58
  5. The carboxyl terminus of the prolactin-releasing peptide receptor interacts with PDZ domain proteins involved in alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor clustering. (PMID: 11641419) Lin SH … Civelli O (Molecular pharmacology 2001) 3 4 58

Products for GRIP2 Gene

Sources for GRIP2 Gene

Content
Loading form....