Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GOLGA6L7 Gene

Aliases for GOLGA6L7 Gene

  • Golgin A6 Family Like 7 2 3 5
  • Golgi Autoantigen, Golgin Subfamily A, 6-Like 7 (Pseudogene) 2 3
  • Golgin Subfamily A Member 6-Like Protein 7 3 4
  • Golgin A6 Family-Like 7, Pseudogene 2 3
  • LOW QUALITY PROTEIN: Golgin Subfamily A Member 6-Like Protein 7 3
  • Golgin A6 Family-Like 9 Pseudogene 3
  • GOLGA6L7P 3

External Ids for GOLGA6L7 Gene

Previous HGNC Symbols for GOLGA6L7 Gene

  • GOLGA6L7P

Previous GeneCards Identifiers for GOLGA6L7 Gene

  • GC15M026888

Summaries for GOLGA6L7 Gene

GeneCards Summary for GOLGA6L7 Gene

GOLGA6L7 (Golgin A6 Family Like 7) is a Protein Coding gene. An important paralog of this gene is GOLGA6L2.

Additional gene information for GOLGA6L7 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GOLGA6L7 Gene

Genomics for GOLGA6L7 Gene

GeneHancer (GH) Regulatory Elements for GOLGA6L7 Gene

Promoters and enhancers for GOLGA6L7 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH15J028847 Enhancer 0.2 Ensembl 600.7 +1.1 1074 0.8 GOLGA6L7 APBA2 LOC100129687 ENSG00000271616 PDCD6IPP2
GH15J028831 Promoter/Enhancer 1.4 Ensembl ENCODE 0.4 +16.0 15974 2.2 ELF3 CC2D1A MLLT1 ZNF121 MAFK TRIM24 SP7 PRDM1 KAT8 GLIS2 LOC100129687 ENSG00000271616 ENSG00000260844 PDCD6IPP2 HERC2P9 GOLGA6L7
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GOLGA6L7 on UCSC Golden Path with GeneCards custom track

Genomic Locations for GOLGA6L7 Gene

Genomic Locations for GOLGA6L7 Gene
chr15:28,841,833-28,848,675
(GRCh38/hg38)
Size:
6,843 bases
Orientation:
Minus strand
chr15:29,087,381-29,093,821
(GRCh37/hg19)
Size:
6,441 bases
Orientation:
Minus strand

Genomic View for GOLGA6L7 Gene

Genes around GOLGA6L7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GOLGA6L7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GOLGA6L7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GOLGA6L7 Gene

Proteins for GOLGA6L7 Gene

  • Protein details for GOLGA6L7 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    A0A1B0GV03-GG6L7_HUMAN
    Recommended name:
    Golgin subfamily A member 6-like protein 7
    Protein Accession:
    A0A1B0GV03

    Protein attributes for GOLGA6L7 Gene

    Size:
    622 amino acids
    Molecular mass:
    75583 Da
    Quaternary structure:
    No Data Available

neXtProt entry for GOLGA6L7 Gene

Post-translational modifications for GOLGA6L7 Gene

No Post-translational modifications

Other Protein References for GOLGA6L7 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for GOLGA6L7 Gene

Domains & Families for GOLGA6L7 Gene

Gene Families for GOLGA6L7 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for GOLGA6L7 Gene

InterPro:
ProtoNet:

Graphical View of Domain Structure for InterPro Entry

A0A1B0GV03

UniProtKB/Swiss-Prot:

GG6L7_HUMAN :
  • Belongs to the GOLGA6 family.
Family:
  • Belongs to the GOLGA6 family.
genes like me logo Genes that share domains with GOLGA6L7: view

No data available for Suggested Antigen Peptide Sequences for GOLGA6L7 Gene

Function for GOLGA6L7 Gene

Animal Model Products

CRISPR Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for GOLGA6L7 Gene

Localization for GOLGA6L7 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for GOLGA6L7 Gene

Pathways & Interactions for GOLGA6L7 Gene

PathCards logo

SuperPathways for GOLGA6L7 Gene

No Data Available

Interacting Proteins for GOLGA6L7 Gene

Gene Ontology (GO) - Biological Process for GOLGA6L7 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for GOLGA6L7 Gene

Drugs & Compounds for GOLGA6L7 Gene

No Compound Related Data Available

Transcripts for GOLGA6L7 Gene

mRNA/cDNA for GOLGA6L7 Gene

(1) REFSEQ mRNAs :
(1) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Alternative Splicing Database (ASD) splice patterns (SP) for GOLGA6L7 Gene

No ASD Table

Relevant External Links for GOLGA6L7 Gene

GeneLoc Exon Structure for
GOLGA6L7
ECgene alternative splicing isoforms for
GOLGA6L7

Expression for GOLGA6L7 Gene

NURSA nuclear receptor signaling pathways regulating expression of GOLGA6L7 Gene:

GOLGA6L7
No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for GOLGA6L7 Gene

Orthologs for GOLGA6L7 Gene

Evolution for GOLGA6L7 Gene

ENSEMBL:
Gene Tree for GOLGA6L7 (if available)
TreeFam:
Gene Tree for GOLGA6L7 (if available)

No data available for Orthologs for GOLGA6L7 Gene

Paralogs for GOLGA6L7 Gene

genes like me logo Genes that share paralogs with GOLGA6L7: view

Variants for GOLGA6L7 Gene

Sequence variations from dbSNP and Humsavar for GOLGA6L7 Gene

SNP ID Clin Chr 15 pos Variation AA Info Type
rs1000063010 -- 28,844,411(-) TGTCATTTGT/TGTCATTTGTGTTGTCATTTGT intron_variant
rs1000135940 -- 28,844,406(-) C/T intron_variant
rs1000246103 -- 28,844,467(-) G/A/T intron_variant
rs1000742223 -- 28,850,064(-) C/G/T upstream_transcript_variant
rs1001360666 -- 28,844,133(-) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for GOLGA6L7 Gene

Variant ID Type Subtype PubMed ID
esv2751526 CNV loss 17911159
nsv1039798 CNV gain 25217958
nsv1040778 CNV loss 25217958
nsv1148560 OTHER inversion 26484159
nsv522597 CNV loss 19592680
nsv527255 CNV gain 19592680
nsv568662 CNV gain 21841781
nsv9223 CNV loss 18304495
nsv976910 CNV duplication 23825009

Additional Variant Information for GOLGA6L7 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
GOLGA6L7

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for GOLGA6L7 Gene

Disorders for GOLGA6L7 Gene

No disorders were found for GOLGA6L7 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for GOLGA6L7 Gene

Publications for GOLGA6L7 Gene

  1. Analysis of the DNA sequence and duplication history of human chromosome 15. (PMID: 16572171) Zody MC … Nusbaum C (Nature 2006) 4 58

Products for GOLGA6L7 Gene

Sources for GOLGA6L7 Gene

Content
Loading form....