Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GNAT3 Gene

Aliases for GNAT3 Gene

  • G Protein Subunit Alpha Transducin 3 2 3 5
  • Guanine Nucleotide Binding Protein, Alpha Transducing 3 2 3
  • Gustducin Alpha-3 Chain 3 4
  • Guanine Nucleotide-Binding Protein G(T) Subunit Alpha-3 3
  • Gustducin, Alpha Polypeptide 3
  • Gustatory G Protein 3
  • GDCA 3

External Ids for GNAT3 Gene

Previous GeneCards Identifiers for GNAT3 Gene

  • GC07M079700
  • GC07M079732
  • GC07M079925
  • GC07M080087
  • GC07M074691

Summaries for GNAT3 Gene

Entrez Gene Summary for GNAT3 Gene

  • Sweet, bitter, and umami tastes are transmitted from taste receptors by a specific guanine nucleotide binding protein. The protein encoded by this gene is the alpha subunit of this heterotrimeric G protein, which is found not only in the oral epithelium but also in gut tissues. Variations in this gene have been linked to metabolic syndrome. [provided by RefSeq, Dec 2015]

GeneCards Summary for GNAT3 Gene

GNAT3 (G Protein Subunit Alpha Transducin 3) is a Protein Coding gene. Among its related pathways are ADP signalling through P2Y purinoceptor 12 and Peptide ligand-binding receptors. Gene Ontology (GO) annotations related to this gene include GTP binding and obsolete signal transducer activity. An important paralog of this gene is GNAT2.

UniProtKB/Swiss-Prot for GNAT3 Gene

  • Guanine nucleotide-binding protein (G protein) alpha subunit playing a prominent role in bitter and sweet taste transduction as well as in umami (monosodium glutamate, monopotassium glutamate, and inosine monophosphate) taste transduction. Transduction by this alpha subunit involves coupling of specific cell-surface receptors with a cGMP-phosphodiesterase; Activation of phosphodiesterase lowers intracellular levels of cAMP and cGMP which may open a cyclic nucleotide-suppressible cation channel leading to influx of calcium, ultimately leading to release of neurotransmitter. Indeed, denatonium and strychnine induce transient reduction in cAMP and cGMP in taste tissue, whereas this decrease is inhibited by GNAT3 antibody. Gustducin heterotrimer transduces response to bitter and sweet compounds via regulation of phosphodiesterase for alpha subunit, as well as via activation of phospholipase C for beta and gamma subunits, with ultimate increase inositol trisphosphate and increase of intracellular Calcium. GNAT3 can functionally couple to taste receptors to transmit intracellular signal: receptor heterodimer TAS1R2/TAS1R3 senses sweetness and TAS1R1/TAS1R3 transduces umami taste, whereas the T2R family GPCRs act as bitter sensors. Functions also as lumenal sugar sensors in the gut to control the expression of the Na+-glucose transporter SGLT1 in response to dietaty sugar, as well as the secretion of Glucagon-like peptide-1, GLP-1 and glucose-dependent insulinotropic polypeptide, GIP. Thus, may modulate the gut capacity to absorb sugars, with implications in malabsorption syndromes and diet-related disorders including diabetes and obesity.

Tocris Summary for GNAT3 Gene

  • Heterotrimeric G proteins are membrane bound GTPases that are linked to 7-TM receptors. Each G protein contains an alpha-, beta- and gamma-subunit and is bound to GDP in the 'off' state. Ligand binding causes a receptor conformational change, detaching the G protein and switching it 'on'.

Gene Wiki entry for GNAT3 Gene

Additional gene information for GNAT3 Gene

No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GNAT3 Gene

Genomics for GNAT3 Gene

GeneHancer (GH) Regulatory Elements for GNAT3 Gene

Promoters and enhancers for GNAT3 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH07J080512 Promoter 0.5 EPDnew 655.8 +15.8 15839 0.1 GNAT3 ENSG00000232667 CD36
GH07J080880 Enhancer 1.3 Ensembl ENCODE dbSUPER 4.9 -355.4 -355413 5.5 PKNOX1 CLOCK ARNT NEUROD1 SIN3A FEZF1 ZNF2 ZNF213 FOS SP3 SEMA3C GNAT3 GC07P080753
GH07J080479 Enhancer 0.8 Ensembl ENCODE 6.9 +47.1 47119 3.3 SMARCE1 STAT1 MAZ RFX1 CEBPB DPF2 KLF4 EP300 CTBP1 GATA3 CD36 GNAT3 ENSG00000232667
GH07J080872 Enhancer 0.9 ENCODE dbSUPER 5.2 -346.0 -345980 1.9 PKNOX1 FEZF1 ZNF697 HIC1 CTBP1 GATA3 ZNF366 POLR2A KLF7 TCF7L2 SEMA3C GNAT3 GC07P080753
GH07J080900 Enhancer 0.8 ENCODE dbSUPER 5.1 -374.0 -374019 3.2 JUN JUNB BATF ATF2 ZNF664 JUND POLR2A ZNF24 ZNF600 FOS SEMA3C GNAT3 GC07M080900 GC07P080753
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GNAT3 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the GNAT3 gene promoter:
  • POU2F1a
  • POU2F1
  • RP58
  • S8
  • AML1a
  • HOXA3
  • p53
  • FOXO4

Genomic Locations for GNAT3 Gene

Genomic Locations for GNAT3 Gene
chr7:80,457,292-80,527,915
(GRCh38/hg38)
Size:
70,624 bases
Orientation:
Minus strand
chr7:80,087,987-80,141,336
(GRCh37/hg19)
Size:
53,350 bases
Orientation:
Minus strand

Genomic View for GNAT3 Gene

Genes around GNAT3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GNAT3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GNAT3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GNAT3 Gene

Proteins for GNAT3 Gene

  • Protein details for GNAT3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    A8MTJ3-GNAT3_HUMAN
    Recommended name:
    Guanine nucleotide-binding protein G(t) subunit alpha-3
    Protein Accession:
    A8MTJ3
    Secondary Accessions:
    • A4D1B2
    • A4D1B3
    • B9EJG5

    Protein attributes for GNAT3 Gene

    Size:
    354 amino acids
    Molecular mass:
    40357 Da
    Quaternary structure:
    • G proteins are composed of 3 units; alpha, beta and gamma, respectively GNAT3, GNB1 and GNG13 for Gustducin heterotrimer for bitter taste transduction. The alpha chain contains the guanine nucleotide binding site. Gustducin heterotrimer may also be composed of GNAT3, GNB3 and GNG13.
    SequenceCaution:
    • Sequence=EAL24192.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=EAL24193.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

neXtProt entry for GNAT3 Gene

Post-translational modifications for GNAT3 Gene

  • Potential N-myristoylation may anchor alpha-subunit to the inner surface of plasma membrane.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for GNAT3 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for GNAT3 Gene

Domains & Families for GNAT3 Gene

Gene Families for GNAT3 Gene

Protein Domains for GNAT3 Gene

Suggested Antigen Peptide Sequences for GNAT3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

A8MTJ3

UniProtKB/Swiss-Prot:

GNAT3_HUMAN :
  • Belongs to the G-alpha family. G(i/o/t/z) subfamily.
Family:
  • Belongs to the G-alpha family. G(i/o/t/z) subfamily.
genes like me logo Genes that share domains with GNAT3: view

Function for GNAT3 Gene

Molecular function for GNAT3 Gene

UniProtKB/Swiss-Prot Function:
Guanine nucleotide-binding protein (G protein) alpha subunit playing a prominent role in bitter and sweet taste transduction as well as in umami (monosodium glutamate, monopotassium glutamate, and inosine monophosphate) taste transduction. Transduction by this alpha subunit involves coupling of specific cell-surface receptors with a cGMP-phosphodiesterase; Activation of phosphodiesterase lowers intracellular levels of cAMP and cGMP which may open a cyclic nucleotide-suppressible cation channel leading to influx of calcium, ultimately leading to release of neurotransmitter. Indeed, denatonium and strychnine induce transient reduction in cAMP and cGMP in taste tissue, whereas this decrease is inhibited by GNAT3 antibody. Gustducin heterotrimer transduces response to bitter and sweet compounds via regulation of phosphodiesterase for alpha subunit, as well as via activation of phospholipase C for beta and gamma subunits, with ultimate increase inositol trisphosphate and increase of intracellular Calcium. GNAT3 can functionally couple to taste receptors to transmit intracellular signal: receptor heterodimer TAS1R2/TAS1R3 senses sweetness and TAS1R1/TAS1R3 transduces umami taste, whereas the T2R family GPCRs act as bitter sensors. Functions also as lumenal sugar sensors in the gut to control the expression of the Na+-glucose transporter SGLT1 in response to dietaty sugar, as well as the secretion of Glucagon-like peptide-1, GLP-1 and glucose-dependent insulinotropic polypeptide, GIP. Thus, may modulate the gut capacity to absorb sugars, with implications in malabsorption syndromes and diet-related disorders including diabetes and obesity.

Phenotypes From GWAS Catalog for GNAT3 Gene

Gene Ontology (GO) - Molecular Function for GNAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001664 G-protein coupled receptor binding IBA --
GO:0003924 GTPase activity TAS --
GO:0004871 obsolete signal transducer activity IBA --
GO:0005525 GTP binding TAS --
GO:0019001 guanyl nucleotide binding IEA --
genes like me logo Genes that share ontologies with GNAT3: view

Phenotypes for GNAT3 Gene

genes like me logo Genes that share phenotypes with GNAT3: view

Animal Models for GNAT3 Gene

MGI Knock Outs for GNAT3:

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for GNAT3 Gene

Localization for GNAT3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for GNAT3 Gene

Cytoplasm. Note=Dual ditribution pattern; plasmalemmal pattern with apical region localization and cytosolic pattern with localization throughout the cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GNAT3 gene
Compartment Confidence
plasma membrane 5
cytoskeleton 3
cytosol 3
mitochondrion 2
extracellular 1
peroxisome 1
nucleus 1
golgi apparatus 1

Gene Ontology (GO) - Cellular Components for GNAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001669 acrosomal vesicle IEA --
GO:0001750 photoreceptor outer segment IBA --
GO:0001917 photoreceptor inner segment IBA --
GO:0005737 cytoplasm IEA --
GO:0005834 heterotrimeric G-protein complex IBA --
genes like me logo Genes that share ontologies with GNAT3: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for GNAT3 Gene

Pathways & Interactions for GNAT3 Gene

genes like me logo Genes that share pathways with GNAT3: view

Gene Ontology (GO) - Biological Process for GNAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001580 detection of chemical stimulus involved in sensory perception of bitter taste IBA --
GO:0006457 protein folding TAS --
GO:0007165 signal transduction IEA --
GO:0007186 G-protein coupled receptor signaling pathway TAS --
GO:0007188 adenylate cyclase-modulating G-protein coupled receptor signaling pathway IBA --
genes like me logo Genes that share ontologies with GNAT3: view

No data available for SIGNOR curated interactions for GNAT3 Gene

Drugs & Compounds for GNAT3 Gene

(2) Drugs for GNAT3 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
calcium Approved Nutra 0
cyclic amp Experimental Pharma 0

(5) Additional Compounds for GNAT3 Gene - From: Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
[D-Trp7,9,10]-Substance P
89430-38-6
G-Protein antagonist peptide
143675-79-0
Gue 1654
397290-30-1
mastoparan
72093-21-1
SCH 202676 hydrobromide
265980-25-4

(5) Tocris Compounds for GNAT3 Gene

Compound Action Cas Number
[D-Trp7,9,10]-Substance P Inhibits M1 ACh receptor activation of Gq/11 89430-38-6
G-Protein antagonist peptide Inhibits G protein activation by GPCRs 143675-79-0
Gue 1654 Selective inhibitor of OXE-R Gbetagamma signaling 397290-30-1
Mastoparan Activates Gi and Go 72093-21-1
SCH 202676 hydrobromide Inhibitor of ligand binding to G-protein-coupled receptors 265980-25-4
genes like me logo Genes that share compounds with GNAT3: view

Transcripts for GNAT3 Gene

mRNA/cDNA for GNAT3 Gene

(2) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(1) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for GNAT3 Gene

Guanine nucleotide binding protein, alpha transducing 3:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for GNAT3 Gene

No ASD Table

Relevant External Links for GNAT3 Gene

GeneLoc Exon Structure for
GNAT3
ECgene alternative splicing isoforms for
GNAT3

Expression for GNAT3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GNAT3 Gene

mRNA differential expression in normal tissues according to GTEx for GNAT3 Gene

This gene is overexpressed in Small Intestine - Terminal Ileum (x13.7), Adipose - Visceral (Omentum) (x12.5), Testis (x10.6), and Thyroid (x6.1).

Protein differential expression in normal tissues from HIPED for GNAT3 Gene

This gene is overexpressed in Urinary Bladder (50.2) and Brain (12.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for GNAT3 Gene



Protein tissue co-expression partners for GNAT3 Gene

NURSA nuclear receptor signaling pathways regulating expression of GNAT3 Gene:

GNAT3

SOURCE GeneReport for Unigene cluster for GNAT3 Gene:

Hs.335049

mRNA Expression by UniProt/SwissProt for GNAT3 Gene:

A8MTJ3-GNAT3_HUMAN
Tissue specificity: Expressed in taste buds (sensory organs of clustered epithelial cells) of the circumvallate and foliate papillae of the tongue at protein level. Expressed in enteroendocrine L cells of the gut. Detected also in spermatozoa.
genes like me logo Genes that share expression patterns with GNAT3: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for GNAT3 Gene

Orthologs for GNAT3 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for GNAT3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia GNAT3 34 33
  • 99.72 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia GNAT3 34
  • 94 (a)
OneToOne
cow
(Bos Taurus)
Mammalia GNAT3 34 33
  • 93.03 (n)
OneToOne
dog
(Canis familiaris)
Mammalia GNAT3 34 33
  • 92.18 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Gnat3 33
  • 88.42 (n)
mouse
(Mus musculus)
Mammalia Gnat3 16 34 33
  • 88.04 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia GNAT3 34
  • 88 (a)
OneToOne
chicken
(Gallus gallus)
Aves GNAT3 34 33
  • 78.63 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia GNAT3 34
  • 85 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii gnao1b 34
  • 60 (a)
ManyToMany
fruit fly
(Drosophila melanogaster)
Insecta G-oalpha47A 34
  • 58 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea goa-1 34
  • 56 (a)
OneToMany
thale cress
(Arabidopsis thaliana)
eudicotyledons GP ALPHA 1 33
  • 51.34 (n)
rice
(Oryza sativa)
Liliopsida Os05g0333200 33
  • 52.96 (n)
Species where no ortholog for GNAT3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for GNAT3 Gene

ENSEMBL:
Gene Tree for GNAT3 (if available)
TreeFam:
Gene Tree for GNAT3 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for GNAT3: view image

Paralogs for GNAT3 Gene

Paralogs for GNAT3 Gene

(19) SIMAP similar genes for GNAT3 Gene using alignment to 1 proteins:

  • GNAT3_HUMAN
genes like me logo Genes that share paralogs with GNAT3: view

Variants for GNAT3 Gene

Sequence variations from dbSNP and Humsavar for GNAT3 Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs1000054545 -- 80,491,301(-) C/A/T intron_variant
rs1000097961 -- 80,475,946(-) G/C intron_variant
rs1000133611 -- 80,479,705(-) T/C intron_variant
rs1000208146 -- 80,482,466(-) ATTTTCTTTTTCTTTTTTCTTTC/ intron_variant
rs1000215055 -- 80,467,428(-) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for GNAT3 Gene

Variant ID Type Subtype PubMed ID
dgv1305e214 CNV loss 21293372
esv2734733 CNV deletion 23290073
esv2734734 CNV deletion 23290073
esv2734735 CNV deletion 23290073
esv2734736 CNV deletion 23290073
esv3363 CNV loss 18987735
esv3613860 CNV loss 21293372
esv3613861 CNV loss 21293372
nsv365325 CNV deletion 16902084
nsv464604 CNV loss 19166990
nsv607680 CNV loss 21841781
nsv607681 CNV loss 21841781
nsv831042 CNV gain 17160897
nsv831043 CNV loss 17160897

Variation tolerance for GNAT3 Gene

Residual Variation Intolerance Score: 63.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.11; 38.46% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for GNAT3 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
GNAT3

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GNAT3 Gene

Disorders for GNAT3 Gene

Additional Disease Information for GNAT3

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for GNAT3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for GNAT3 Gene

Publications for GNAT3 Gene

  1. Gut-expressed gustducin and taste receptors regulate secretion of glucagon-like peptide-1. (PMID: 17724330) Jang HJ … Egan JM (Proceedings of the National Academy of Sciences of the United States of America 2007) 3 4 22 58
  2. Colocalization of the alpha-subunit of gustducin with PYY and GLP-1 in L cells of human colon. (PMID: 16728727) Rozengurt N … Rozengurt E (American journal of physiology. Gastrointestinal and liver physiology 2006) 3 4 22 58
  3. Taste genes associated with dental caries. (PMID: 20858777) Wendell S … Marazita ML (Journal of dental research 2010) 3 44 58
  4. Expression of the G-protein alpha-subunit gustducin in mammalian spermatozoa. (PMID: 17021831) Fehr J … Boekhoff I (Journal of comparative physiology. A, Neuroethology, sensory, neural, and behavioral physiology 2007) 3 4 58
  5. T1R3 and gustducin in gut sense sugars to regulate expression of Na+-glucose cotransporter 1. (PMID: 17724332) Margolskee RF … Shirazi-Beechey SP (Proceedings of the National Academy of Sciences of the United States of America 2007) 3 4 58

Products for GNAT3 Gene

Sources for GNAT3 Gene

Content
Loading form....