Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GNAS-AS1 Gene

Subcategory (RNA class) for GNAS-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

13

Aliases for GNAS-AS1 Gene

  • GNAS Antisense RNA 1 2 3 5
  • GNAS Antisense RNA 1 (Non-Protein Coding) 2 3
  • GNAS Antisense RNA (Non-Protein Coding) 2
  • Non-Protein Coding RNA 75 2
  • GNAS1 Antisense 3
  • GNAS Antisense 2
  • NCRNA00075 3
  • GNAS1AS 3
  • NESP-AS 3
  • GNAS-AS 3
  • NESPAS 3
  • GNASAS 3
  • SANG 3

External Ids for GNAS-AS1 Gene

Previous HGNC Symbols for GNAS-AS1 Gene

  • GNASAS
  • GNAS-AS

Previous GeneCards Identifiers for GNAS-AS1 Gene

  • GC20M057395
  • GC20M057397
  • GC20M057400
  • GC20M057403
  • GC20M058819
  • GC20M058820
  • GC20M058822
  • GC20M058824
  • GC20M058825
  • GC20M058826
  • GC20M058828
  • GC20M058830

Summaries for GNAS-AS1 Gene

Entrez Gene Summary for GNAS-AS1 Gene

  • This gene produces a paternally-imprinted antisense RNA transcript that helps regulate the GNAS complex locus, which encodes the alpha subunit of the stimulatory G protein. Defects in this gene are a cause of pseudohypoparathyroidism type Ib.[provided by RefSeq, Jun 2010]

GeneCards Summary for GNAS-AS1 Gene

GNAS-AS1 (GNAS Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with GNAS-AS1 include Pseudohypoparathyroidism, Type Ib and Diabetes Mellitus, Transient Neonatal, 1.

Gene Wiki entry for GNAS-AS1 Gene

Additional gene information for GNAS-AS1 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GNAS-AS1 Gene

Genomics for GNAS-AS1 Gene

GeneHancer (GH) Regulatory Elements for GNAS-AS1 Gene

Promoters and enhancers for GNAS-AS1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH20J058850 Promoter/Enhancer 1.5 Ensembl ENCODE dbSUPER 650.7 +0.2 202 1.4 PKNOX1 SIN3A ZBTB7B ZBTB40 RFX5 ZNF335 GLIS2 ELK1 SCRT2 FOS ENSG00000274491 ENSG00000275069 GNAS-AS1 GNAS
GH20J058851 Enhancer 0.6 ENCODE dbSUPER 650.7 -0.7 -658 0.3 USF1 SUZ12 EZH2 ENSG00000274491 ENSG00000275069 GNAS-AS1 GNAS ENSG00000270951
GH20J058849 Enhancer 0.3 Ensembl 650.7 +1.2 1202 0.2 PAX8 ENSG00000274491 ENSG00000275069 GNAS-AS1 ENSG00000276722 GNAS
GH20J058647 Enhancer 1 Ensembl ENCODE dbSUPER 11.1 +203.0 203000 0.9 SMARCA5 CTCF PKNOX1 HLF NRF1 RAD21 ZNF664 JUND GLIS2 POLR2A NPEPL1 GNAS GNAS-AS1 GC20M058648 LINC01711
GH20J058881 Enhancer 1 Ensembl ENCODE dbSUPER 10.4 -31.9 -31880 2.9 CTCF RNF2 L3MBTL2 HLF MNT ZIC2 ATF4 POLR2A TARDBP SCRT2 NELFCD GNAS-AS1 GNAS ENSG00000270951 LOC101927932
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GNAS-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for GNAS-AS1 Gene

Genomic Locations for GNAS-AS1 Gene
chr20:58,818,918-58,850,903
(GRCh38/hg38)
Size:
31,986 bases
Orientation:
Minus strand
chr20:57,393,973-57,425,958
(GRCh37/hg19)
Size:
31,986 bases
Orientation:
Minus strand

Genomic View for GNAS-AS1 Gene

Genes around GNAS-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GNAS-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GNAS-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GNAS-AS1 Gene

Proteins for GNAS-AS1 Gene

Post-translational modifications for GNAS-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for GNAS-AS1 Gene

Domains & Families for GNAS-AS1 Gene

Gene Families for GNAS-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with GNAS-AS1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for GNAS-AS1 Gene

Function for GNAS-AS1 Gene

Phenotypes From GWAS Catalog for GNAS-AS1 Gene

Human Phenotype Ontology for GNAS-AS1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for GNAS-AS1 Gene

Localization for GNAS-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for GNAS-AS1 Gene

Pathways & Interactions for GNAS-AS1 Gene

SuperPathways for GNAS-AS1 Gene

No Data Available

Interacting Proteins for GNAS-AS1 Gene

Gene Ontology (GO) - Biological Process for GNAS-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for GNAS-AS1 Gene

Drugs & Compounds for GNAS-AS1 Gene

No Compound Related Data Available

Transcripts for GNAS-AS1 Gene

mRNA/cDNA for GNAS-AS1 Gene

(1) Additional mRNA sequences :
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :
(5) RNA Central transcripts :

Unigene Clusters for GNAS-AS1 Gene

GNAS antisense RNA 1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for GNAS-AS1 Gene

No ASD Table

Relevant External Links for GNAS-AS1 Gene

GeneLoc Exon Structure for
GNAS-AS1
ECgene alternative splicing isoforms for
GNAS-AS1

Expression for GNAS-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GNAS-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for GNAS-AS1 Gene

This gene is overexpressed in Pituitary (x15.2), Brain - Hypothalamus (x14.0), Minor Salivary Gland (x8.6), and Pancreas (x5.0).

SOURCE GeneReport for Unigene cluster for GNAS-AS1 Gene:

Hs.122718

Phenotype-based relationships between genes and organs from Gene ORGANizer for GNAS-AS1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • endocrine
  • nervous
  • respiratory
  • skeletal muscle
  • urinary
Regions:
Head and neck:
  • brain
  • ear
  • eye
  • head
  • larynx
  • neck
  • parathyroid
  • thyroid
Thorax:
  • heart
Abdomen:
  • kidney
General:
  • blood vessel
  • peripheral nerve
  • peripheral nervous system
genes like me logo Genes that share expression patterns with GNAS-AS1: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for GNAS-AS1 Gene

Orthologs for GNAS-AS1 Gene

Evolution for GNAS-AS1 Gene

ENSEMBL:
Gene Tree for GNAS-AS1 (if available)
TreeFam:
Gene Tree for GNAS-AS1 (if available)

No data available for Orthologs for GNAS-AS1 Gene

Paralogs for GNAS-AS1 Gene

No data available for Paralogs for GNAS-AS1 Gene

Variants for GNAS-AS1 Gene

Sequence variations from dbSNP and Humsavar for GNAS-AS1 Gene

SNP ID Clin Chr 20 pos Variation AA Info Type
rs79527543 not-provided, benign, not specified, not provided 58,840,821(-) C/A intron_variant
rs144308406 uncertain-significance, not specified 58,840,116(-) A/G intron_variant
rs886042434 uncertain-significance, not specified 58,840,583(-) CACCCAGCGTCTGCACGCTCTCAAGTTGCGAAGCCCCG/ intron_variant
rs587778387 not-provided, not specified 58,840,451(-) CGAGTCCGAAATCGAGTCCGA/CGAGTCCGA intron_variant
rs587778388 not-provided, not specified 58,840,438(-) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for GNAS-AS1 Gene

Variant ID Type Subtype PubMed ID
esv1197292 CNV insertion 17803354
esv2461600 CNV insertion 19546169
nsv459031 CNV loss 19166990
nsv474420 CNV novel sequence insertion 20440878
nsv586352 CNV loss 21841781
nsv828763 CNV loss 20364138
nsv955142 CNV deletion 24416366

Additional Variant Information for GNAS-AS1 Gene

Human Gene Mutation Database (HGMD)
GNAS-AS1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
GNAS-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for GNAS-AS1 Gene

Disorders for GNAS-AS1 Gene

MalaCards: The human disease database

(6) MalaCards diseases for GNAS-AS1 Gene - From: HGMD, LncRNADisease, OMIM, ClinVar, GTR, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for GNAS-AS1

genes like me logo Genes that share disorders with GNAS-AS1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for GNAS-AS1 Gene

Publications for GNAS-AS1 Gene

  1. An imprinted antisense transcript at the human GNAS1 locus. (PMID: 10749992) Hayward BE … Bonthron DT (Human molecular genetics 2000) 2 3 58
  2. Genome-wide DNA methylation analysis of pseudohypoparathyroidism patients with GNAS imprinting defects. (PMID: 26819647) Rochtus A … Freson K (Clinical epigenetics 2016) 3 58
  3. Genome-wide DNA methylation analysis of transient neonatal diabetes type 1 patients with mutations in ZFP57. (PMID: 27075368) Bak M … Tommerup N (BMC medical genetics 2016) 3 58
  4. Expression of imprinted genes in placenta is associated with infant neurobehavioral development. (PMID: 26198301) Green BB … Marsit CJ (Epigenetics 2015) 3 58
  5. Methylation and transcripts expression at the imprinted GNAS locus in human embryonic and induced pluripotent stem cells and their derivatives. (PMID: 25241742) Grybek V … Silve C (Stem cell reports 2014) 3 58

Products for GNAS-AS1 Gene

Sources for GNAS-AS1 Gene

Content
Loading form....