Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GAGE13 Gene

Aliases for GAGE13 Gene

  • G Antigen 13 2 3 4 5
  • G Antigen 12A 2 3 4
  • GAGE-12A 3 4
  • GAGE12A 3 4
  • GAGE-13 3 4

External Ids for GAGE13 Gene

Previous HGNC Symbols for GAGE13 Gene

  • GAGE12A

Previous GeneCards Identifiers for GAGE13 Gene

  • GC0XP049076
  • GC0XP049073
  • GC0XP049077
  • GC0XP049200
  • GC0XP049208
  • GC0XP049211
  • GC0XP049225
  • GC0XP049230
  • GC0XP049239
  • GC0XP049249
  • GC0XP049255
  • GC0XP049260
  • GC0XP049265
  • GC0XP049332

Summaries for GAGE13 Gene

GeneCards Summary for GAGE13 Gene

GAGE13 (G Antigen 13) is a Protein Coding gene. An important paralog of this gene is GAGE12F.

Additional gene information for GAGE13 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GAGE13 Gene

Genomics for GAGE13 Gene

GeneHancer (GH) Regulatory Elements for GAGE13 Gene

Promoters and enhancers for GAGE13 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH0XJ049610 Enhancer 0.8 ENCODE 31.9 +279.2 279172 0.9 CEBPG RERE TFE3 SP7 PKNOX1 ZNF488 SOX13 ZIC2 CEBPA GATAD2A GAGE13 ENSG00000270012 WDR45 GAGE2A VDAC1P2
GH0XJ049308 Enhancer 0.7 ENCODE 34.3 -22.2 -22150 2.3 SP1 PRDM1 IKZF1 IKZF2 RFX1 MGA EGR1 NR2C2 ZFHX2 IRF2 GAGE13 GAGE10 GAGE12J
GH0XJ049315 Enhancer 0.6 Ensembl 34.3 -15.9 -15915 1.4 TRIM24 IKZF1 ZNF512 ZNF24 SOX6 ATF2 DPF2 TCF12 ATF1 TAL1 GAGE13 PQBP1 GAGE12J GAGE10
GH0XJ049292 Enhancer 0.6 ENCODE 34.2 -39.5 -39528 0.2 CC2D1A CTCF RAD21 REST CTBP1 MTA3 EHMT2 SMC3 ZNF189 SKIL GAGE13 FOXP3 PPP1R3F PIR47304 ENSG00000286031
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GAGE13 on UCSC Golden Path with GeneCards custom track

Genomic Locations for GAGE13 Gene

Genomic Locations for GAGE13 Gene
chrX:49,331,616-49,338,952
(GRCh38/hg38)
Size:
7,337 bases
Orientation:
Plus strand
chrX:49,188,094-49,195,366
(GRCh37/hg19)
Size:
7,273 bases
Orientation:
Plus strand

Genomic View for GAGE13 Gene

Genes around GAGE13 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GAGE13 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GAGE13 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GAGE13 Gene

Proteins for GAGE13 Gene

  • Protein details for GAGE13 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q4V321-GAG13_HUMAN
    Recommended name:
    G antigen 13
    Protein Accession:
    Q4V321
    Secondary Accessions:
    • A0A087X111

    Protein attributes for GAGE13 Gene

    Size:
    117 amino acids
    Molecular mass:
    12957 Da
    Quaternary structure:
    No Data Available
    Miscellaneous:
    • This gene belongs to a multigene family expressed in a large variety of tumors whereas in normal tissues, expression is restricted to germ cells. These genes organized in clustered repeats, have a high degree of predicted sequence identity, but differ by scattered single nucleotide substitution. Their sequences contain either the antigenic peptide YYWPRPRRY or YRPRPRRY which is recognized by cytotoxic T-cells.

neXtProt entry for GAGE13 Gene

Post-translational modifications for GAGE13 Gene

No Post-translational modifications

Other Protein References for GAGE13 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for GAGE13 Gene

Domains & Families for GAGE13 Gene

Gene Families for GAGE13 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for GAGE13 Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for GAGE13 Gene

GenScript: Design optimal peptide antigens:
  • G antigen 12A (GAG13_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q4V321

UniProtKB/Swiss-Prot:

GAG13_HUMAN :
  • Belongs to the GAGE family.
Family:
  • Belongs to the GAGE family.
genes like me logo Genes that share domains with GAGE13: view

Function for GAGE13 Gene

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for GAGE13

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for GAGE13 Gene

Localization for GAGE13 Gene

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (1)
  • Golgi apparatus (1)
  • Plasma membrane (1)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for GAGE13 Gene

Pathways & Interactions for GAGE13 Gene

PathCards logo

SuperPathways for GAGE13 Gene

No Data Available

Interacting Proteins for GAGE13 Gene

STRING Interaction Network Preview (showing top 1 STRING interactants - click image to see details)
https://version11.string-db.org/api/image/network?species=9606&limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000483811%0d9606.ENSP00000282570%0d
Selected Interacting proteins: ENSP00000483811 for GAGE13 Gene via STRING

Symbol External ID(s) Details
GMCL1

Gene Ontology (GO) - Biological Process for GAGE13 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for GAGE13 Gene

Drugs & Compounds for GAGE13 Gene

No Compound Related Data Available

Transcripts for GAGE13 Gene

mRNA/cDNA for GAGE13 Gene

(1) REFSEQ mRNAs :
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for GAGE13

Alternative Splicing Database (ASD) splice patterns (SP) for GAGE13 Gene

No ASD Table

Relevant External Links for GAGE13 Gene

GeneLoc Exon Structure for
GAGE13
ECgene alternative splicing isoforms for
GAGE13

Expression for GAGE13 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GAGE13 Gene

mRNA differential expression in normal tissues according to GTEx for GAGE13 Gene

This gene is overexpressed in Testis (x53.0).

NURSA nuclear receptor signaling pathways regulating expression of GAGE13 Gene:

GAGE13
genes like me logo Genes that share expression patterns with GAGE13: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for GAGE13 Gene

Orthologs for GAGE13 Gene

Evolution for GAGE13 Gene

ENSEMBL:
Gene Tree for GAGE13 (if available)
TreeFam:
Gene Tree for GAGE13 (if available)

No data available for Orthologs for GAGE13 Gene

Paralogs for GAGE13 Gene

(26) SIMAP similar genes for GAGE13 Gene using alignment to 1 proteins:

  • GAG13_HUMAN
genes like me logo Genes that share paralogs with GAGE13: view

Variants for GAGE13 Gene

Sequence variations from dbSNP and Humsavar for GAGE13 Gene

SNP ID Clin Chr 0X pos Variation AA Info Type
rs112750640 -- 49,338,051(+) T/C intron_variant
rs1157074814 -- 49,335,008(+) C/G/T intron_variant
rs1157248843 -- 49,335,473(+) A/G intron_variant
rs1157349418 -- 49,332,073(+) T/C intron_variant
rs1157511343 -- 49,333,462(+) GTGTGTGTGTGCACGTGTGTGTGTG/GTGTGTGTGTG intron_variant

Structural Variations from Database of Genomic Variants (DGV) for GAGE13 Gene

Variant ID Type Subtype PubMed ID
esv3399100 CNV duplication 20981092
esv3408787 CNV duplication 20981092
nsv1129077 CNV duplication 24896259
nsv515202 CNV gain 21397061
nsv6897 CNV insertion 18451855

Additional Variant Information for GAGE13 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
GAGE13

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for GAGE13 Gene

Disorders for GAGE13 Gene

Additional Disease Information for GAGE13

No disorders were found for GAGE13 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for GAGE13 Gene

Publications for GAGE13 Gene

  1. An overview of the GAGE cancer/testis antigen family with the inclusion of newly identified members. (PMID: 18179644) Gjerstorff MF … Ditzel HJ (Tissue antigens 2008) 3 4 58
  2. The DNA sequence of the human X chromosome. (PMID: 15772651) Ross MT … Bentley DR (Nature 2005) 3 4 58
  3. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 58
  4. Creation of genome-wide protein expression libraries using random activation of gene expression. (PMID: 11329013) Harrington JJ … Ducar M (Nature biotechnology 2001) 3 58

Products for GAGE13 Gene

Sources for GAGE13 Gene

Content
Loading form....