Aliases for FTL Gene
Aliases for FTL Gene
External Ids for FTL Gene
- HGNC: 3999
- Entrez Gene: 2512
- Ensembl: ENSG00000087086
- OMIM: 134790
- UniProtKB: P02792
Previous GeneCards Identifiers for FTL Gene
- GC19P050126
- GC19P049836
- GC19P054145
- GC19P054160
- GC19P049468
- GC19P045848
Summaries for FTL Gene
-
This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]
GeneCards Summary for FTL Gene
FTL (Ferritin Light Chain) is a Protein Coding gene. Diseases associated with FTL include Neurodegeneration With Brain Iron Accumulation 3 and Hyperferritinemia With Or Without Cataract. Among its related pathways are Vesicle-mediated transport and Clathrin derived vesicle budding. Gene Ontology (GO) annotations related to this gene include identical protein binding and ferric iron binding. An important paralog of this gene is FTH1.
UniProtKB/Swiss-Prot for FTL Gene
-
Stores iron in a soluble, non-toxic, readily available form. Important for iron homeostasis. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. Also plays a role in delivery of iron to cells. Mediates iron uptake in capsule cells of the developing kidney (By similarity).
Additional gene information for FTL Gene
- Monarch Initiative
- Search for FTL at DataMed
- Search for FTL at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FTL Gene
Genomics for FTL Gene
GeneHancer (GH) Regulatory Elements for FTL Gene
Promoters and enhancers for FTL Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around FTL on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the FTL gene promoter:
-
- STAT1
Genomic Locations for FTL Gene
Genomic Locations for FTL Gene
- chr19:48,965,309-48,966,879
- (GRCh38/hg38)
- Size:
- 1,571 bases
- Orientation:
- Plus strand
- chr19:49,468,558-49,470,136
- (GRCh37/hg19)
- Size:
- 1,579 bases
- Orientation:
- Plus strand
Genomic View for FTL Gene
Genes around FTL on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 19q13.33 by HGNC
- 19q13.33 by Entrez Gene
- 19q13.33 by Ensembl
FTL Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for FTL Gene
Proteins for FTL Gene
-
Protein details for FTL Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P02792-FRIL_HUMAN
- Recommended name:
- Ferritin light chain
- Protein Accession:
- P02792
- B2R4B9
- Q6IBT7
- Q7Z2W1
- Q86WI9
- Q8WU07
- Q96AU9
- Q96CU0
- Q9BTZ8
Protein attributes for FTL Gene
- Size:
- 175 amino acids
- Molecular mass:
- 20020 Da
- Quaternary structure:
-
- Oligomer of 24 subunits. There are two types of subunits: L (light) chain and H (heavy) chain. The major chain can be light or heavy, depending on the species and tissue type. The functional molecule forms a roughly spherical shell with a diameter of 12 nm and contains a central cavity into which the insoluble mineral iron core is deposited. Iron enters the spherical protein shell through pores that are formed between subunits. Mutations leading to truncation or the addition of extra residues at the C-terminus interfere with normal pore formation and with iron accumulation.
- SequenceCaution:
-
- Sequence=CAE11873.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};
Protein Expression for FTL Gene
Post-translational modifications for FTL Gene
Other Protein References for FTL Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
G Biosciences
- Immunotag™ Ferritin Light Chain mouse mAb (ITM1422-100u)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 350 (ITM1422-100u-350)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 647 (ITM1422-50u-647)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 594 (ITM1422-100u-594)
- Immunotag™ Ferritin (LC) monoclonal antibody-FITC (ITM1422-50u-F)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 488 (ITM1422-100u-488)
- Immunotag™ Ferritin Light Chain mouse mAb (ITM1422-50u)
- Immunotag™ Ferritin (LC) monoclonal antibody-HRP (ITM1422-50u-H)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 555 (ITM1422-50u-555)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 647 (ITM1422-100u-647)
- Immunotag™ Ferritin (LC) monoclonal antibody-Biotin (ITM1422-50u-B)
- Immunotag™ Ferritin (LC) monoclonal antibody-Biotin (ITM1422-100u-B)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 594 (ITM1422-50u-594)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 350 (ITM1422-50u-350)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 405 (ITM1422-50u-405)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 488 (ITM1422-50u-488)
- Immunotag™ Ferritin (LC) monoclonal antibody-FITC (ITM1422-100u-F)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 555 (ITM1422-100u-555)
- Immunotag™ Ferritin (LC) monoclonal antibody-HRP (ITM1422-100u-H)
- Immunotag™ Ferritin (LC) monoclonal antibody-Alexa Fluor® 405 (ITM1422-100u-405)
- Immunotag™ FTL Antibody (ITA6684-200u)
- Immunotag™ FTL Antibody (ITA6684-100u)
- Atlas Antibodies Anti-FTL Antibody
- Novus Biologicals Antibodies for FTL
-
Abcam antibodies for FTL
- Invitrogen Antibodies for FTL (AFLGC-FTL)
- antibodies-online: Search results for 270 available FTL Antibodies ranked by validation data
- Compare Top FTL Antibodies
-
Recommended
- 22 WB Antibodies (anti-mouse)
- 12 IF (p) Antibodies (anti-mouse)
- 147 WB Antibodies (anti-human)
- 43 IHC (p) Antibodies (anti-human)
- 12 FACS Antibodies (anti-human)
- 12 IF (p) Antibodies (anti-human)
- 5 RIA Antibodies (anti-human)
- 3 IHC Antibodies (anti-human)
- 20 WB Antibodies (anti-rat)
- 12 IF (p) Antibodies (anti-rat)
-
Santa Cruz Biotechnology (SCBT) Antibodies for FTL
- Sino Biological Antibodies for FTL
Protein Products
- G Biosciences Human Ferritin light chain/FTL, Lyophilized
- Atlas Antibodies PrEST Antigen FTL
- Search Origene for MassSpec and Protein Over-expression Lysates for FTL
- Origene Custom Protein Services for FTL
- Sino Biological Recombinant Proteins for FTL
- Browse Sino Biological Cell Lysates
-
ProSci Proteins for FTL
-
Abcam proteins for FTL
Assay Products
- Aviva Systems Biology FTL ELISA Kit (Human) : 96 Wells (OKEH02751) and FTL ELISA Kit (Human) (OKCD08356)
- antibodies-online: Search results for 48 available FTL Elisa Kits ranked by validation data
- Compare Top FTL Elisa Kits
-
Recommended
- 1 Chicken ELISA Kit
- 4 Cow (Bovine) ELISA Kits
- 4 Dog (Canine) ELISA Kits
- 1 Goat ELISA Kit
- 2 Guinea Pig ELISA Kits
- 1 Horse (Equine) ELISA Kit
- 15 Human ELISA Kits
- 2 Monkey ELISA Kits
- 5 Mouse (Murine) ELISA Kits
- 4 Pig (Porcine) ELISA Kits
- 2 Rabbit ELISA Kits
- 5 Rat (Rattus) ELISA Kits
- 2 Sheep (Ovine) ELISA Kits
- Sino Biological Assays for FTL
No data available for DME Specific Peptides for FTL Gene
Domains & Families for FTL Gene
Gene Families for FTL Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Cancer-related genes
- Candidate cardiovascular disease genes
- Disease related genes
- FDA approved drug targets
- Plasma proteins
- Predicted intracellular proteins
Protein Domains for FTL Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for FTL Gene
- GenScript: Design optimal peptide antigens:
-
- Ferritin (B1Q387_HUMAN)
- Ferritin (B1Q3B3_HUMAN)
- Ferritin (F5H1X1_HUMAN)
- Ferritin light chain (FRIL_HUMAN)
- Ferritin (Q4FCH6_HUMAN)
Graphical View of Domain Structure for InterPro Entry
P02792- Family:
-
- Belongs to the ferritin family.
Function for FTL Gene
Molecular function for FTL Gene
- UniProtKB/Swiss-Prot Function:
- Stores iron in a soluble, non-toxic, readily available form. Important for iron homeostasis. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. Also plays a role in delivery of iron to cells. Mediates iron uptake in capsule cells of the developing kidney (By similarity).
- GENATLAS Biochemistry:
- ferritin,light polypeptide,19kDa,19.9kDa,non-storage protein
Phenotypes From GWAS Catalog for FTL Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0004322 | ferroxidase activity | IBA | 21873635 |
| GO:0005506 | iron ion binding | IDA | 19923220 |
| GO:0005515 | protein binding | IPI | 16169070 |
| GO:0008198 | ferrous iron binding | IBA | 21873635 |
| GO:0008199 | ferric iron binding | IBA | 21873635 |
Phenotypes for FTL Gene
- GenomeRNAi human phenotypes for FTL:
-
- Increased number of mitotic cells
- G0/1 arrest
- Decreased cell number
- Decreased NANOG protein expression
- Decreased OCT4 protein expression
- Decreased POU5F1-GFP protein expression
- Dynamic nuclei (hole, folded or small irregular)
- Negative genetic interaction between BLM-/- and BLM+/+
- Negative genetic interaction between MUS81-/- and MUS81+/+
- Decreased viability
- no effect
- Increased vaccinia virus (VACV) infection
- Decreased NF-kappaB reporter expression
- Increased viability
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for FTL
-
CRISPR Products
- Applied Biological Materials (abm): CRISPR Clones for FTL - Now 50% OFF >
- * FTL CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * FTL CRISPR applications: KO, Activation, Repression, and more - Browse All
-
OriGene CRISPR knockouts for FTL
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for FTL
- genomics-online: gRNA clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
-
Santa Cruz Biotechnology (SCBT) CRISPR for FTL
miRNA for FTL Gene
- miRTarBase miRNAs that target FTL
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for FTL
- Browse OriGene Inhibitory RNA Products For FTL
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for FTL
- genomics-online: shRNA clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
Clone Products
- Applied Biological Materials (abm): Clones for FTL - Now 50% OFF >
- * FTL as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * FTL tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
- Sino Biological Human cDNA Clone for FTL
- Addgene plasmids for FTL
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for FTL
Cell Line Products
-
Horizon Cell Lines for FTL
No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for FTL Gene
Localization for FTL Gene
| Compartment | Confidence |
|---|---|
| cytosol | 5 |
| lysosome | 5 |
| extracellular | 4 |
| mitochondrion | 2 |
| nucleus | 2 |
| cytoskeleton | 1 |
- Cytosol (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005576 | extracellular region | TAS | -- |
| GO:0005623 | cell | IEA | -- |
| GO:0005737 | cytoplasm | IBA | 21873635 |
| GO:0005829 | cytosol | TAS | -- |
| GO:0008043 | intracellular ferritin complex | TAS,IDA | 19923220 |
No data available for Subcellular locations from UniProtKB/Swiss-Prot for FTL Gene
Pathways & Interactions for FTL Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Clathrin derived vesicle budding | ||
| 2 | Innate Immune System |
.61
|
|
| 3 | Necroptosis | ||
| 4 | Binding and Uptake of Ligands by Scavenger Receptors | ||
| 5 | Vesicle-mediated transport | ||
Pathways by source for FTL Gene
2 BioSystems pathways for FTL Gene
12 Reactome pathways for FTL Gene
3 KEGG pathways for FTL Gene
Interacting Proteins for FTL Gene
Selected Interacting proteins:
P02792-FRIL_HUMAN
ENSP00000366525
for FTL Gene via
UniProtKB
MINT
STRING
IID
GPS-Prot Interaction Network for FTL
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006826 | iron ion transport | IEA | -- |
| GO:0006879 | cellular iron ion homeostasis | TAS | -- |
| GO:0006880 | intracellular sequestering of iron ion | IBA | 21873635 |
| GO:0043312 | neutrophil degranulation | TAS | -- |
| GO:0055072 | iron ion homeostasis | TAS | 19923220 |
No data available for SIGNOR curated interactions for FTL Gene
Drugs & Compounds for FTL Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| Iron | Approved, Experimental | Pharma | 1426 | |||
| Ferric pyrophosphate citrate | Approved, Investigational | Pharma | Target, binder | 0 | ||
| Ferrous sulfate anhydrous | Approved | Pharma | Transporter, storage | 0 | ||
| Ferumoxytol | Approved, Investigational | Pharma | Transporter, storage | 0 | ||
| Gallium citrate Ga 67 | Approved | Pharma | Transporter, substrate | 0 |
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
|---|
Drug Products
- G Biosciences Human Ferritin light chain/FTL, Lyophilized
- Atlas Antibodies PrEST Antigen FTL
Transcripts for FTL Gene
mRNA/cDNA for FTL Gene
- (1) REFSEQ mRNAs :
- (31) Additional mRNA sequences :
- (32) Selected AceView cDNA sequences:
- (1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000331825 871 bps (ENST00000331825.10)
Unigene Clusters for FTL Gene
CRISPR Products
- Applied Biological Materials (abm): CRISPR Clones for FTL - Now 50% OFF >
- * FTL CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * FTL CRISPR applications: KO, Activation, Repression, and more - Browse All
-
OriGene CRISPR knockouts for FTL
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for FTL
- genomics-online: gRNA clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
-
Santa Cruz Biotechnology (SCBT) CRISPR for FTL
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for FTL
- Browse OriGene Inhibitory RNA Products For FTL
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for FTL
- genomics-online: shRNA clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
Clone Products
- Applied Biological Materials (abm): Clones for FTL - Now 50% OFF >
- * FTL as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * FTL tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
- Sino Biological Human cDNA Clone for FTL
- Addgene plasmids for FTL
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for FTL
| ExUns: | 1a | · | 1b | ^ | 2a | · | 2b | ^ | 3a | · | 3b | · | 3c | ^ | 4a | · | 4b |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | ||||||||||||||||
| SP2: | |||||||||||||||||
| SP3: | |||||||||||||||||
| SP4: | |||||||||||||||||
| SP5: |
Expression for FTL Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Thymus (Hematopoietic System)
- T-Cytotoxic Cells Thymus
-
Blood (Cardiovascular System)
- T-Cytotoxic Cells Thymus
- Endoderm (Gastrulation Derivatives)
-
Spinal Cord (Nervous System)
mRNA differential expression in normal tissues according to GTEx for FTL Gene
This gene is overexpressed in Whole Blood (x7.5).
This gene is overexpressed in Liver, secretome (29.2).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for FTL Gene
NURSA nuclear receptor signaling pathways regulating expression of FTL Gene:
FTLSOURCE GeneReport for Unigene cluster for FTL Gene:
Hs.433670Evidence on tissue expression from TISSUES for FTL Gene
- Intestine(5)
- Kidney(5)
- Liver(5)
- Lung(5)
- Skin(5)
- Nervous system(5)
- Blood(4.9)
- Pancreas(4.9)
- Eye(4.7)
- Spleen(4.6)
- Heart(4.5)
- Bone(4.4)
- Muscle(4.1)
- Stomach(3.6)
- Gall bladder(3)
- Bone marrow(2.8)
- Lymph node(2.8)
- Thyroid gland(2.8)
- Adrenal gland(2.7)
Phenotype-based relationships between genes and organs from Gene ORGANizer for FTL Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- cardiovascular
- digestive
- immune
- integumentary
- nervous
- respiratory
- skeletal muscle
Regions:
Head and neck:
- brain
- cerebellum
- epiglottis
- eye
- eyelid
- face
- head
- larynx
- mouth
- neck
- pharynx
- vocal cord
Thorax:
- esophagus
- trachea
Abdomen:
- liver
- stomach
Limb:
- digit
- finger
- foot
- hand
- lower limb
- upper limb
- wrist
General:
- blood
- red blood cell
- skin
- spinal cord
- white blood cell
Primer Products
-
OriGene qPCR primer pairs for FTL
-
OriGene qPCR primer pairs and template standards for FTL
- genomics-online: primer clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
Gene Expression Assay Products
No data available for mRNA Expression by UniProt/SwissProt for FTL Gene
Orthologs for FTL Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | FTL 35 34 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | LOC102155200 34 |
|
||
| FTL 35 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| cow (Bos Taurus) |
Mammalia | LOC788801 34 |
|
||
| FTL 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| rat (Rattus norvegicus) |
Mammalia | Ftl1 34 |
|
||
| mouse (Mus musculus) |
Mammalia | Ftl1 35 34 |
|
OneToMany | |
| Gm10116 35 |
|
OneToMany | |||
| Ftl1-ps2 17 |
|
|
|||
| oppossum (Monodelphis domestica) |
Mammalia | -- 35 |
|
OneToMany | |
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| platypus (Ornithorhynchus anatinus) |
Mammalia | FTL 35 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | FTD 35 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | FTL 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | MGC75752 34 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | FTL 35 |
|
OneToOne | |
| fruit fly (Drosophila melanogaster) |
Insecta | Fer3HCH 35 |
|
OneToMany | |
| Fer1HCH 35 |
|
OneToMany | |||
| worm (Caenorhabditis elegans) |
Secernentea | ftn-2 35 |
|
OneToMany | |
| ftn-1 35 |
|
OneToMany | |||
| sea squirt (Ciona savignyi) |
Ascidiacea | CSA.11041 35 |
|
OneToOne |
- Species where no ortholog for FTL was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for FTL Gene
- ENSEMBL:
- Gene Tree for FTL (if available)
- TreeFam:
- Gene Tree for FTL (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for FTL: view image
Paralogs for FTL Gene
(5) SIMAP similar genes for FTL Gene using alignment to 7 proteins:
- FRIL_HUMAN
- B1Q387_HUMAN
- B1Q3B3_HUMAN
- M1KCE4_HUMAN
- Q4FCH6_HUMAN
- Q6DMM8_HUMAN
- Q6S4P3_HUMAN
Pseudogenes.org Pseudogenes for FTL Gene
- PGOHUM00000290563
- PGOHUM00000290713
- PGOHUM00000292035
- PGOHUM00000292874
- PGOHUM00000293365
- PGOHUM00000293893
- PGOHUM00000294281
- PGOHUM00000294342
- PGOHUM00000295166
- PGOHUM00000295772
- PGOHUM00000296200
- PGOHUM00000296282
- PGOHUM00000297010
- PGOHUM00000299899
- PGOHUM00000300235
- PGOHUM00000302127
- PGOHUM00000304144
- PGOHUM00000304556
- PGOHUM00000304991
Variants for FTL Gene
| SNP ID | Clin | Chr 19 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs104894685 | pathogenic, Neuroferritinopathy, Neurodegeneration with brain iron accumulation 3 (NBIA3) [MIM:606159] | 48,966,317(+) | G/A | coding_sequence_variant, missense_variant | |
| rs1114167274 | pathogenic, Neuroferritinopathy | 48,966,702(+) | TCTCT/TCTCTCT | coding_sequence_variant, frameshift | |
| rs139732572 | pathogenic, L-ferritin deficiency | 48,965,508(+) | A/G | coding_sequence_variant, initiator_codon_variant, missense_variant | |
| rs1555796939 | pathogenic, Hyperferritinemia cataract syndrome | 48,965,318(+) | CGGTCCCGCGGGTCTGTCTCTTGCTTCAAC/C | 5_prime_UTR_variant, coding_sequence_variant, frameshift | |
| rs1555797038 | uncertain-significance, Hyperferritinemia cataract syndrome, Neuroferritinopathy | 48,965,861(+) | G/A | coding_sequence_variant, missense_variant |
Residual Variation Intolerance Score:
23.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
0.39;
8.67% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for FTL Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FTL Gene
Disorders for FTL Gene
(17) MalaCards diseases for FTL Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| neurodegeneration with brain iron accumulation 3 |
|
|
| hyperferritinemia with or without cataract |
|
|
| l-ferritin deficiency |
|
|
| genetic hyperferritinemia without iron overload |
|
|
| neurodegeneration with brain iron accumulation |
|
|
Search FTL in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
FRIL_HUMAN- Hyperferritinemia with or without cataract (HRFTC) [MIM:600886]: An autosomal dominant disease characterized by elevated level of ferritin in serum and tissues, and early-onset bilateral cataract. Cataracts may be subclinical in some patients. {ECO:0000269 PubMed:19176363}. Note=The disease is caused by mutations affecting the gene represented in this entry.
- Neurodegeneration with brain iron accumulation 3 (NBIA3) [MIM:606159]: A neurodegenerative disorder associated with iron accumulation in the brain, primarily in the basal ganglia. It is characterized by a variety of neurological signs including parkinsonism, ataxia, corticospinal signs, mild non-progressive cognitive deficit and episodic psychosis. It is linked with decreased serum ferritin levels. {ECO:0000269 PubMed:16116125}. Note=The disease is caused by mutations affecting the gene represented in this entry.
- L-ferritin deficiency (LFTD) [MIM:615604]: A condition characterized by low levels of ferritin in serum and tissues in the absence of other hematological symptoms. Seizures and mild neuropsychologic impairment may manifest in individuals with complete ferritin deficiency. {ECO:0000269 PubMed:23940258}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for FTL
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for FTL Gene
Publications for FTL Gene
- A new missense mutation in the L ferritin coding sequence associated with elevated levels of glycosylated ferritin in serum and absence of iron overload. (PMID: 19176363) Kannengiesser C … Beaumont C (Haematologica 2009) 3 4 23 58
- Structure of human ferritin L chain. (PMID: 16790936) Wang Z … Carter DC (Acta crystallographica. Section D, Biological crystallography 2006) 3 4 23 58
- Screening for mutations of the ferritin light and heavy genes in Parkinson's disease patients with hyperechogenicity of the substantia nigra. (PMID: 14615048) Felletschin B … Berg D (Neuroscience letters 2003) 3 23 45 58
- Mutant ferritin L-chains that cause neurodegeneration act in a dominant-negative manner to reduce ferritin iron incorporation. (PMID: 20159981) Luscieti S … Arosio P (The Journal of biological chemistry 2010) 3 4 58
- Genetic variation and antioxidant response gene expression in the bronchial airway epithelium of smokers at risk for lung cancer. (PMID: 20689807) Wang X … Bell DA (PloS one 2010) 3 45 58
ExternalLinks
Products for FTL Gene
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for MassSpec and Protein Over-expression Lysates for FTL
- Origene Custom Protein Services for FTL
- Origene sirna, shrna, and RNAi products in human, mouse, rat for FTL
- Browse OriGene Inhibitory RNA Products For FTL
- OriGene qPCR primer pairs for FTL
- OriGene qPCR primer pairs and template standards for FTL
- OriGene CRISPR knockouts for FTL
- OriGene ORF clones in human for FTL
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For FTL
- Sino Biological Human cDNA Clone for FTL
- Sino Biological Recombinant Proteins for FTL
- Browse Sino Biological Cell Lysates
- Sino Biological Antibodies for FTL
- Sino Biological Assays for FTL
- Browse Recombinant Proteins
- Browse Antibodies
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for FTL
- Novus Biologicals proteins and lysates for FTL
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for FTL
- Abcam proteins for FTL
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for FTL (AFLGC-FTL)
- antibodies-online: Search results for 270 available FTL Antibodies ranked by validation data
- Compare Top FTL Antibodies
- Recommended
- 22 WB Antibodies (anti-mouse)
- 12 IF (p) Antibodies (anti-mouse)
- 147 WB Antibodies (anti-human)
- 43 IHC (p) Antibodies (anti-human)
- 12 FACS Antibodies (anti-human)
- 12 IF (p) Antibodies (anti-human)
- 5 RIA Antibodies (anti-human)
- 3 IHC Antibodies (anti-human)
- 20 WB Antibodies (anti-rat)
- 12 IF (p) Antibodies (anti-rat)
- antibodies-online: Search results for 48 available FTL Elisa Kits ranked by validation data
- Compare Top FTL Elisa Kits
- Recommended
- 1 Chicken ELISA Kit
- 4 Cow (Bovine) ELISA Kits
- 4 Dog (Canine) ELISA Kits
- 1 Goat ELISA Kit
- 2 Guinea Pig ELISA Kits
- 1 Horse (Equine) ELISA Kit
- 15 Human ELISA Kits
- 2 Monkey ELISA Kits
- 5 Mouse (Murine) ELISA Kits
- 4 Pig (Porcine) ELISA Kits
- 2 Rabbit ELISA Kits
- 5 Rat (Rattus) ELISA Kits
- 2 Sheep (Ovine) ELISA Kits
- antibodies-online: Search results for 24 available FTL Proteins ranked by validation data
- Compare Top FTL Proteins
- Santa Cruz Biotechnology (SCBT) Antibodies for FTL
- Search Santa Cruz Biotechnology (SCBT) for FTL siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for FTL
- Search for FTL Antibodies at ProSci
- Custom Antibody Services
- ProSci Proteins for FTL
- Horizon Cell Lines for FTL
- genomics-online: cdna clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
- orf clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
- genomics-online: gRNA clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
- genomics-online: primer clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
- genomics-online: shRNA clones - Search results for 174 available FTL gene related products
- Overview of 174 available FTL gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for FTL
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for FTL
- Search GeneCopoeia for miRNA 3'UTR Target clone products for FTL
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for FTL
Sources for FTL Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) UniGene
- (28) AceView
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) HGMD
- (45) GAD
- (46) BGMUT
- (47) HuGE
- (48) Atlas
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) OCA
- (69) Proteopedia
- (70) MOPED
- (71) neXtProt
- (72) Reactome
- (73) GeneGo (Thomson Reuters)
- (74) fRNAdb
- (75) DISEASES
- (76) SIMAP
- (77) GenomeRNAi
- (78) LifeMap
- (79) miRTarBase
- (80) MalaCards
- (81) Invitrogen
- (82) BitterDB
- (83) ESI-BIO
- (84) RefSeq
- (85) BioSystems
- (86) MaxQB
- (87) IUPHAR
- (88) BioGPS
- (89) Illumina
- (90) COMPARTMENTS
- (91) HOMER
- (92) PaxDb
- (93) ApexBio
- (94) Addgene
- (95) antibodies-online
- (96) CYP
- (97) NONCODE
- (98) SwitchGear Genomics
- (99) TreeFam
- (100) PathCards
- (101) GeneReviews
- (102) GeneTex
- (103) Taconic Biosciences
- (104) GTEx
- (105) ProteomicsDB
- (106) SCBT
- (107) DGIdb
- (108) ClinicalTrials
- (109) FDA Approved Drugs
- (110) RVIS
- (111) SIGNOR
- (112) diseasecard
- (113) NIH Rare Diseases
- (114) Orphanet
- (115) UMLS
- (116) GTR
- (117) Disease Ontology
- (118) Genetics Home Reference
- (119) MeSH
- (120) MedlinePlus
- (121) CDC
- (122) NINDS
- (123) NCBI Bookshelf
- (124) ClinVar
- (125) Gene Damage Index
- (126) ViGene Biosciences
- (127) HPO
- (128) UDN
- (129) VISTA
- (130) FANTOM5
- (131) ENCODE
- (132) ProSci
- (133) Horizon
- (134) NURSA
- (135) IID
- (136) Cyagen
- (137) VectorBuilder
- (138) SNPedia
- (139) BRCA Exchange
- (140) St John's Lab
- (141) CIViC
- (142) ProteoGenix
- (143) dbSUPER
- (144) TISSUES
- (145) Gene ORGANizer
- (146) abm
- (147) CrownBio
- (148) Human Protein Atlas
- (149) GWAS Catalog
- (150) Monarch Initiative
- (151) DataMed
- (152) HumanCyc
- (153) genomics-online
- (154) UCNEbase
- (155) EPDnew
- (156) Applied Biosystems
- (157) GlyConnect
- (158) Aminode
- (159) GeneCopoeia
- (160) GPS-Prot
- (161) RNACentral
- (162) LncRNADisease
- (163) LOVD
- (164) miR2Disease
- (165) DiseaseEnhancer
- (166) Boster Bio
- (167) Biorbyt
- (168) Biocompare
- (169) Mastermind