Mutations in the winged-helix transcription factor gene at the nude locus in mice and rats produce the pleiotropic phenotype of hairlessness and athymia, resulting in a severely compromised immune system. This gene is orthologous to the mouse and rat genes and encodes a similar DNA-binding transcription factor that is thought to regulate keratin gene expression. A mutation in t... See more...

Aliases for FOXN1 Gene

Aliases for FOXN1 Gene

  • Forkhead Box N1 2 3 5
  • Winged-Helix Transcription Factor Nude 3 4
  • Forkhead Box Protein N1 3 4
  • Winged-Helix Nude 2 3
  • Rowett Nude 2 3
  • RONU 3 4
  • WHN 3 4
  • FKHL20 3

External Ids for FOXN1 Gene

Previous HGNC Symbols for FOXN1 Gene

  • WHN
  • RONU

Previous GeneCards Identifiers for FOXN1 Gene

  • GC17P026702
  • GC17P026996
  • GC17P023875
  • GC17P026850
  • GC17P023059

Summaries for FOXN1 Gene

Entrez Gene Summary for FOXN1 Gene

  • Mutations in the winged-helix transcription factor gene at the nude locus in mice and rats produce the pleiotropic phenotype of hairlessness and athymia, resulting in a severely compromised immune system. This gene is orthologous to the mouse and rat genes and encodes a similar DNA-binding transcription factor that is thought to regulate keratin gene expression. A mutation in this gene has been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing in the 5' UTR of this gene has been observed. [provided by RefSeq, Jul 2008]

GeneCards Summary for FOXN1 Gene

FOXN1 (Forkhead Box N1) is a Protein Coding gene. Diseases associated with FOXN1 include T-Cell Immunodeficiency, Congenital Alopecia, And Nail Dystrophy and Alopecia. Gene Ontology (GO) annotations related to this gene include DNA-binding transcription factor activity and DNA-binding transcription factor activity, RNA polymerase II-specific. An important paralog of this gene is FOXK2.

UniProtKB/Swiss-Prot Summary for FOXN1 Gene

  • Transcriptional regulator which regulates the development, differentiation, and function of thymic epithelial cells (TECs) both in the prenatal and postnatal thymus. Acts as a master regulator of the TECs lineage development and is required from the onset of differentiation in progenitor TECs in the developing fetus to the final differentiation steps through which TECs mature to acquire their full functionality. Regulates, either directly or indirectly the expression of a variety of genes that mediate diverse aspects of thymus development and function, including MHC Class II, DLL4, CCL25, CTSL, CD40 and PAX1. Regulates the differentiation of the immature TECs into functional cortical TECs (cTECs) and medullary TECs (mTECs). Essential for maintenance of mTECs population in the postnatal thymus. Involved in the morphogenesis and maintenance of the three-dimensional thymic microstructure which is necessary for a fully functional thymus. Plays an important role in the maintenance of hematopoiesis and particularly T lineage progenitors within the bone marrow niche with age. Essential for the vascularization of the thymus anlage. Promotes the terminal differentiation of epithelial cells in the epidermis and hair follicles, partly by negatively regulating the activity of protein kinase C (By similarity). Plays a crucial role in the early prenatal stages of T-cell ontogeny (PubMed:21507891).

Gene Wiki entry for FOXN1 Gene

Additional gene information for FOXN1 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for FOXN1 Gene

Genomics for FOXN1 Gene

GeneHancer (GH) Regulatory Elements for FOXN1 Gene

Promoters and enhancers for FOXN1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J028508 Enhancer 0.8 Ensembl ENCODE dbSUPER 761.9 +1.7 1672 1.8 ZNF121 PRDM1 SCRT2 CEBPB FOXN1 PIGS SPAG5-AS1 RSKR SLC46A1 lnc-FOXN1-2 ENSG00000258472 RF00017-2319
GH17J028506 Promoter/Enhancer 0.5 EPDnew dbSUPER 750.6 0.0 -9 0.1 FOXN1 PIGS SPAG5-AS1 RSKR SLC46A1 RF00017-2322 ENSG00000258472 RF00017-2319
GH17J028507 Promoter/Enhancer 0.5 EPDnew dbSUPER 750.6 +0.3 301 0.1 FOXN1 PIGS SPAG5-AS1 RSKR SLC46A1 lnc-FOXN1-2 ENSG00000258472 RF00017-2319
GH17J028509 Promoter/Enhancer 0.5 EPDnew dbSUPER 750.6 +0.1 105 0.1 FOXN1 PIGS SPAG5-AS1 RSKR SLC46A1 lnc-FOXN1-2 ENSG00000258472 RF00017-2319
GH17J028546 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE CraniofacialAtlas 12.1 +44.2 44181 7.7 CTCF ZBTB6 POLR2A ZNF362 ZNF701 ETV6 RELA L3MBTL2 RAD21 ZNF148 UNC119 PIGS ENSG00000264577 NUFIP2 LOC101927018 PHF12 ENSG00000265205 SDF2 FOXN1 SUPT6H
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around FOXN1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the FOXN1 gene promoter:
  • AREB6
  • c-Myc
  • Max1
  • NF-kappaB
  • NF-kappaB1
  • Nkx2-5
  • Olf-1
  • SRF
  • SRF (504 AA)

Genomic Locations for FOXN1 Gene

Genomic Locations for FOXN1 Gene
chr17:28,506,229-28,538,900
(GRCh38/hg38)
Size:
32,672 bases
Orientation:
Plus strand
chr17:26,833,261-26,865,914
(GRCh37/hg19)
Size:
32,654 bases
Orientation:
Plus strand

Genomic View for FOXN1 Gene

Genes around FOXN1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FOXN1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FOXN1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FOXN1 Gene

Proteins for FOXN1 Gene

  • Protein details for FOXN1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O15353-FOXN1_HUMAN
    Recommended name:
    Forkhead box protein N1
    Protein Accession:
    O15353
    Secondary Accessions:
    • B2R9Q7
    • O15352

    Protein attributes for FOXN1 Gene

    Size:
    648 amino acids
    Molecular mass:
    68925 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for FOXN1 Gene

neXtProt entry for FOXN1 Gene

Post-translational modifications for FOXN1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for FOXN1 Gene

Domains & Families for FOXN1 Gene

Gene Families for FOXN1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for FOXN1 Gene

Suggested Antigen Peptide Sequences for FOXN1 Gene

GenScript: Design optimal peptide antigens:
  • Winged-helix transcription factor nude (FOXN1_HUMAN)
genes like me logo Genes that share domains with FOXN1: view

No data available for Graphical View of Domain Structure and UniProtKB/Swiss-Prot for FOXN1 Gene

Function for FOXN1 Gene

Molecular function for FOXN1 Gene

UniProtKB/Swiss-Prot Function:
Transcriptional regulator which regulates the development, differentiation, and function of thymic epithelial cells (TECs) both in the prenatal and postnatal thymus. Acts as a master regulator of the TECs lineage development and is required from the onset of differentiation in progenitor TECs in the developing fetus to the final differentiation steps through which TECs mature to acquire their full functionality. Regulates, either directly or indirectly the expression of a variety of genes that mediate diverse aspects of thymus development and function, including MHC Class II, DLL4, CCL25, CTSL, CD40 and PAX1. Regulates the differentiation of the immature TECs into functional cortical TECs (cTECs) and medullary TECs (mTECs). Essential for maintenance of mTECs population in the postnatal thymus. Involved in the morphogenesis and maintenance of the three-dimensional thymic microstructure which is necessary for a fully functional thymus. Plays an important role in the maintenance of hematopoiesis and particularly T lineage progenitors within the bone marrow niche with age. Essential for the vascularization of the thymus anlage. Promotes the terminal differentiation of epithelial cells in the epidermis and hair follicles, partly by negatively regulating the activity of protein kinase C (By similarity). Plays a crucial role in the early prenatal stages of T-cell ontogeny (PubMed:21507891).

Phenotypes From GWAS Catalog for FOXN1 Gene

Gene Ontology (GO) - Molecular Function for FOXN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific NAS 19274049
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific IEA --
GO:0003677 DNA binding IEA --
GO:0003700 DNA-binding transcription factor activity IEA --
GO:0043565 sequence-specific DNA binding IEA --
genes like me logo Genes that share ontologies with FOXN1: view
genes like me logo Genes that share phenotypes with FOXN1: view

Human Phenotype Ontology for FOXN1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for FOXN1 Gene

MGI Knock Outs for FOXN1:
  • Foxn1 Foxn1<tm1.1(KOMP)Vlcg>
  • Foxn1 Foxn1<tm1Tbo>

Animal Model Products

  • Taconic Biosciences Mouse Models for FOXN1

CRISPR Products

miRNA for FOXN1 Gene

miRTarBase miRNAs that target FOXN1

Clone Products

  • Addgene plasmids for FOXN1

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for FOXN1 Gene

Localization for FOXN1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for FOXN1 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FOXN1 gene
Compartment Confidence
nucleus 5
cytosol 2
extracellular 1

Gene Ontology (GO) - Cellular Components for FOXN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,TAS --
genes like me logo Genes that share ontologies with FOXN1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for FOXN1 Gene

Pathways & Interactions for FOXN1 Gene

PathCards logo

SuperPathways for FOXN1 Gene

No Data Available

SIGNOR curated interactions for FOXN1 Gene

Inactivates:
Is activated by:

Gene Ontology (GO) - Biological Process for FOXN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001942 hair follicle development IEA --
GO:0002260 lymphocyte homeostasis IEA --
GO:0002360 T cell lineage commitment IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006357 regulation of transcription by RNA polymerase II TAS 10767081
genes like me logo Genes that share ontologies with FOXN1: view

No data available for Pathways by source for FOXN1 Gene

Drugs & Compounds for FOXN1 Gene

No Compound Related Data Available

Transcripts for FOXN1 Gene

mRNA/cDNA for FOXN1 Gene

(2) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(3) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

  • Addgene plasmids for FOXN1

Alternative Splicing Database (ASD) splice patterns (SP) for FOXN1 Gene

ExUns: 1a · 1b ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8
SP1:
SP2:

Relevant External Links for FOXN1 Gene

GeneLoc Exon Structure for
FOXN1
ECgene alternative splicing isoforms for
FOXN1

Expression for FOXN1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FOXN1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FOXN1 Gene

This gene is overexpressed in Skin - Sun Exposed (Lower leg) (x18.8), Skin - Not Sun Exposed (Suprapubic) (x17.1), Esophagus - Mucosa (x8.0), and Vagina (x4.2).

Protein differential expression in normal tissues from HIPED for FOXN1 Gene

This gene is overexpressed in Heart (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for FOXN1 Gene



Protein tissue co-expression partners for FOXN1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of FOXN1 Gene:

FOXN1

SOURCE GeneReport for Unigene cluster for FOXN1 Gene:

Hs.663679

mRNA Expression by UniProt/SwissProt for FOXN1 Gene:

O15353-FOXN1_HUMAN
Tissue specificity: Expressed in thymus.

Evidence on tissue expression from TISSUES for FOXN1 Gene

  • Skin(2.7)
  • Blood(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for FOXN1 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • immune
  • integumentary
  • lymphatic
Regions:
Limb:
  • digit
  • finger
  • foot
  • hand
  • lower limb
  • nail
  • toe
  • upper limb
General:
  • blood
  • bone marrow
  • hair
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with FOXN1: view

Orthologs for FOXN1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for FOXN1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FOXN1 33 32
  • 99.13 (n)
OneToOne
dog
(Canis familiaris)
Mammalia FOXN1 33 32
  • 90.2 (n)
OneToOne
cow
(Bos Taurus)
Mammalia FOXN1 33 32
  • 89.49 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Foxn1 17 33 32
  • 85.13 (n)
rat
(Rattus norvegicus)
Mammalia Foxn1 32
  • 83.95 (n)
oppossum
(Monodelphis domestica)
Mammalia FOXN1 33
  • 70 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia FOXN1 33
  • 65 (a)
OneToOne
chicken
(Gallus gallus)
Aves FOXN1 33 32
  • 63.57 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia FOXN1 33
  • 64 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia foxn1 32
  • 59.5 (n)
zebrafish
(Danio rerio)
Actinopterygii foxn1 33 32
  • 58.73 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta jumu 33
  • 21 (a)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes FHL1 33
  • 9 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 68 (a)
OneToMany
Species where no ortholog for FOXN1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FOXN1 Gene

ENSEMBL:
Gene Tree for FOXN1 (if available)
TreeFam:
Gene Tree for FOXN1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for FOXN1: view image

Paralogs for FOXN1 Gene

Variants for FOXN1 Gene

Sequence variations from dbSNP and Humsavar for FOXN1 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs104894562 pathogenic, T-cell immunodeficiency, congenital alopecia and nail dystrophy 28,529,157(+) C/T coding_sequence_variant, stop_gained
rs1064793129 likely-pathogenic, uncertain-significance, not provided, T-cell immunodeficiency, congenital alopecia and nail dystrophy 28,534,759(+) CCTGGGCTGTCCGCCCCCTGGGCTGTCCG/CCTGGGCTGTCCG coding_sequence_variant, frameshift, intron_variant
rs115771646 likely-benign, benign, not specified, T-cell immunodeficiency, congenital alopecia and nail dystrophy 28,534,996(+) G/A coding_sequence_variant, intron_variant, missense_variant, synonymous_variant
rs1161194345 uncertain-significance, T-cell immunodeficiency, congenital alopecia and nail dystrophy 28,535,155(+) CC/C coding_sequence_variant, downstream_transcript_variant, frameshift, genic_downstream_transcript_variant, intron_variant
rs116778145 likely-benign, benign, not specified, T-cell immunodeficiency, congenital alopecia and nail dystrophy 28,534,786(+) C/T coding_sequence_variant, intron_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for FOXN1 Gene

Variant ID Type Subtype PubMed ID
nsv1064087 CNV gain 25217958
nsv1064958 CNV loss 25217958

Variation tolerance for FOXN1 Gene

Residual Variation Intolerance Score: 70.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.08; 87.65% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for FOXN1 Gene

Human Gene Mutation Database (HGMD)
FOXN1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
FOXN1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FOXN1 Gene

Disorders for FOXN1 Gene

MalaCards: The human disease database

(10) MalaCards diseases for FOXN1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
t-cell immunodeficiency, congenital alopecia, and nail dystrophy
  • alymphoid cystic thymic dysgenesis
alopecia
thymus squamous cell carcinoma
  • epidermoid thymic carcinoma
thymic dysplasia
type c thymoma
  • thymoma, type c
- elite association - COSMIC cancer census association via MalaCards
Search FOXN1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

FOXN1_HUMAN
  • T-cell immunodeficiency, congenital alopecia, and nail dystrophy (TIDAND) [MIM:601705]: A disorder characterized by the association of congenital alopecia, severe T-cell immunodeficiency, and ridging and pitting of all nails. {ECO:0000269 PubMed:10206641, ECO:0000269 PubMed:21507891}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for FOXN1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with FOXN1: view

No data available for Genatlas for FOXN1 Gene

Publications for FOXN1 Gene

  1. Characterization of mouse and human nude genes. (PMID: 9321431) Schorpp M … Boehm T (Immunogenetics 1997) 2 3 4 23 56
  2. FOXN1 mutation abrogates prenatal T-cell development in humans. (PMID: 21507891) Vigliano I … Pignata C (Journal of medical genetics 2011) 3 4 56
  3. Maternal genes and facial clefts in offspring: a comprehensive search for genetic associations in two population-based cleft studies from Scandinavia. (PMID: 20634891) Jugessur A … Murray JC (PloS one 2010) 3 43 56
  4. Human clinical phenotype associated with FOXN1 mutations. (PMID: 20429426) Pignata C … Amorosi S (Advances in experimental medicine and biology 2009) 3 23 56
  5. Forkhead/winged-helix transcription factor Whn regulates hair keratin gene expression: molecular analysis of the nude skin phenotype. (PMID: 10767081) Schlake T … Boehm T (Developmental dynamics : an official publication of the American Association of Anatomists 2000) 3 23 56

Products for FOXN1 Gene

Sources for FOXN1 Gene